Description :
From Genome Similarity Track
Location :
Scaffold_43:11269- 18325
Transcript NameFunction/comments
Phymu_g2375hypothetical protein
Phymu_g2376hypothetical protein PHYSODRAFT_316672
Phymu_g2377hypothetical protein PHYSODRAFT_347005
Phymu_g2378hypothetical protein PHYSODRAFT_335160

Sequence
7056 bases(100 bases per row)
TCCGATTTAAGTgatatggctacatctgAAGAGGTCTAAATATCTCATGcaggagctcttcctgcgtcAACTGGTGTTTCCCTTCGGCTTCAATGCTAGT
GTTCGCCTCTCGAGATCGAGCGAATATGCGAGGACTTGGCCTCCGAAAGTGCTTGCTAGAAGCGTGCGGCTGTCCACCCTGCACAGACTCGTGAACATTC
GCTTGGCTCCTTCTGCATGAGCTTCAGCTAGTGGAGAGAGTGTAGTGGCATCCCACGCCTTCACCGTCCCGTCCTTGGACGCAGTCACTGGGATCATCGG
GAGAGCTCCAGACTCCATCTCGATCTCGCTACTGTCCGCAGATCGGGGCACGAAACAGCACGCAGTTGCATCCTGTTGGTGTCCTGTGAACTCCAGGACC
TGCTTGCCAGTGCGTCGGTCCCAAACTCGCGCCTCGCATCCAACGCCGTTGAAACCTTTGCTGGAAGTGAGCAGATACGTGTCGTCCCTCTCGCCGTATG
CCGCGATGCTTAGAGGGAAGTACACAAATCCTCGTAGCGACTGGGCAGGCACGCGTAGAGGCGTTCTCGGGTCCCAAAGTTTTACACTCAAGTCCTCACT
GCCCTGTGCGACTAGAGCTTCTCCTGGGAGCCACGTCGAGCACGTAACGACGTTCTGCGGCGTCGTATTCTTGGCTGTGATGTGGCTCGTTGTCAAGTCC
CAGAAAATGGTCTGCGTGTCTCGCCCCCCGGAGCACAACATCCGCTCGGCATCGTCCACCGCCACCGTTGACACGTTCAGTTGGTGGCCGCGAAGTACAG
TCGCCGTCTCGGACGCAGGTTTATCAGTGATGGGCGTGATGGCCACCGTCGTGTCCCTAGAGCACGAGTAGATCATCTGCAGTTTCTCTCCAATGACGAT
GCGGTTCACCGCTCGAGAGTGCGGCTTCCAGACGTTGACAGGGGCGAGGCTGCTACTGCGCCAATTCATACGGTGGATGGATCCGTCCTCCCACCCTGCG
AGGCAATGGCCGCCCAGGAACGAGCTGTACGCGACACAGTTGAGCGCCAAGTCGCTCTCCTGGTCAATCGCCGCAGTAGCAGCTTGGTCATCCGCGCCAG
TTGGCGTTGAAGCGGTCCCGTCGACGACAGTTGgcgtctcctcgtccactttCCAGTTGTTGAGGCGGCGAGGAGACTTGTTGGCGTCGCGGGAGGTGCA
GGCGCCCATGGTGGCAGCGGGGTGAGGGGTGTAGCAGCTCCGTCGAGGTcgagcgacgaagagcacaAGTGGTCAAACCGCCTGCATCGTCCTCGCGTCT
TTCCAACGGCTTTATTGTGCCTCGATTACAGACGTTTAGGTTGAAATGCTGTAGGAGAGGATGCATGTTGTATGAGAGGTTACTGTACTCTCTTAATTCG
AGAGCCACACGTGCGTACACCTCTCACGTTTAAAATGTCGGCCACGAACCAAGTCACGCGCACTACGATCCAGGTGCGTCCTGTACTGCTGTAGCCGTTG
TATATCCACTTTCCTGGTATGACTGACGCTTTGCTTATTGTCTGTGCAGTTGTACCGCGACTGCCTCCGACTGGCCAAGCACATTGGCGGCAACGTACGC
GTGGCTGTTTCAGTGTTGGTGTCGATGGTTTTGTCAGCGCTGACTTGCTGTTGTGTTGATGTGTTGTGCTCCGGTTTCTAATACATGCAGAGCAAGAAGG
GCCAGGCTATCAAGGACCTCGTGCGAAGGGAATTCGACAAGGGCCGCAGCGAGACGGACCCGGAGAAGATTGAGGCGCTCAAGGCCAAGTACGTCCATCG
TTTGGATCTAGTTGACGCTGACGTTTGACTGCTCACTTGTGCGTGCTGTAAATTTGTGTCTGCAGTGCCGTCCGCGGCTTGAGCAACTACCTGATGCTGG
CGAATTCCAGCAAGGACCAGCGGCTGCACGACGCCATGAACAAGAAGTCGCCGCCCAAGGACGACGGACCCGACCAAGCCGAATACCGAGACCTGTGAGC
TAGagcgacttcaacgtgctaCACAACGTCGCGTTGGCATCCGCCAAGTGTTGCAAGGATCTTTTGCCTCGTGTCCAGCATCCTTCGCCATGACTCTATG
ACCATTTTACTTCGTTCTCAGCTAAACTGAACGTCGGCGATGTTGTACCTTTCACATTTGGTTAATTGGCCACAGTCATGCCTTTTGTAGACGTAAGACC
TGCAGCAACTCGAGAGAATGAAGCAACCTTTACGTGGCATCCGAATTGAGTTTGTTTAACATGTTAAAACAACAGGGTTAAAAACGTTTTGCCATGCATA
AAATACGAAACTGTTATAACCGCAAAACTCGGATAAAATCATTTCACACCACTTACGTATCCGTCGACGATGAACCGCAGGGCATTGGCACGGAAGGCTG
CGGGCGCCAAGACGGCGGCCCCGAGCAGCGTCAGCGCCGAGAACGTGGGCGTGGAGAATGTCAgcaagaaactggagctgcagctggcggcGGGCGACTT
CTACGGCGCGTTGCAGATGTACAAGACGCTGTTCATGCGTTTCCTCAAGGGGGACGAACCCAGcgccgagcagcaggagaaggcggcggctCTGGCGCTT
GAGGccgcgctgcagctggtccAGCACGACCAGAACACGGCGGCCACTGAGATGGCCAACCTCATGGTCTCCGTCTTCGCAGACTTCCACCACCCGGTGG
ACGACGCGCACAAACAGCGGATCCGCCAGATCAACGCCGCTTTCGAGCCAAAGCCGCAGTTCAGCAGTGACCTGGCCGTATTCCTCAAGAACGCGGTCAA
GTGGTCGTCTACTGAAGGCTCTCGCAAGCGTGGAgacccggagctgcagctatTGCTGGCACGCGCCTACCGCACGGCGGGGGACTTTACGCACGCCTTG
AAGCACTTTTTACATGCTGAAAACCcgcaggagctggccgagGCGCTGTTCGAGTGGTCCTTGAAGGGATATCCCAGTGAATCCGACCTGTATCtcgctc
gtgctgtgctgcagtaAGAGATTTCGATGGTTTACGGGGGTGAAAAGCTGGAGCTAATGCGTTCTGTGTGTGTTTGTAGACTGCTGAGTCTGGAGAACCT
GCGCGACGCCAACAAGGTCTACGAGGCTTACGTGGCCAAGTgtcaaagtgctggacgTCCTGTGGATCTGCCGCTGTTTAACTTCTCAAGGTTCCTActg
ctgacgctggaggtgAGGCAGCTGTAGAGGGTCTTGCTGGTTGAAGTGATCTCTTACTGTTTTTGTGAATGTTTCTTTAGCGTGATGCACTTCCACTCTT
CCAAATGCTCCAGGAGCGCTACGGTCCGGCACTTGCTCGTGATAGCAGTCTCAAGAGCGTACGTACCTGCCCTAAGCCTCTTGTGTTGAGCGTTCGCTAA
CGTTTGTCCTTTGCTGGTCGGCTCAGTATTTAAGCGTCATCGGTCAGAAGTTCTACGGACTGCAGCCTCCTCGATCGGGACTGAGCTCTCTGCTTGAGAT
GTTCTCGGGCGGCATGTAGAGATCACAATCGTTCGCTAGCACTAGGAGACGGACTGTGGCTTCCAACAGAGGCGTATCCACGAAGACTGAAGGCAAACGT
GTTGACTGTTGTTTCGCTAACTCTTGCAGCCTTCTACTGTCTTGAAGGTTCTCATTTCCTCGACGTCGCGGGGCGGTAATAGTCAAGTGAGCTGGCAGTC
GCAGGTTTGGCCAGAGCGcgcgcctgcttctcgatctcctcgatcCTCAGTAGCGTCGCCGACTTGATCGGCATGATCTTGGGCTTGCACAGCACTTCCG
TCAGATTGCCACGCTCCGAGTACACGAGTCCGGCTTTCGGGAGCACTTCCTGGATctggacacgctgcagaCAGAGCAAGGTAAAAGGTTCTTCATTCAG
TCACCATCGCCtaaacagcagcagttcctgtaCCTGCATGCTTTGCGACTGGACGGGATGGATCTCCTCTACCAAAGTGACTCCTCAACTGGAAAACGGC
AAAACTTGTCTATATATTCGCAGCAAATCTCTCTGTCGTCCTATgccttgctcttcttctgcttcttggccttcttcttgtcctgctgctgcgacttcCG
CTTGAGGTTTTCCACCATCGCGTTGAGCGTGTGCTTGCCGCTATCGCCACTGCCAGTCGAGTCCGACTTGGCAGGTTTCGTCTCCGCAGAAACTGCGTCC
TGGTCGTACCGGTGCCTTCGCTCCTTGAAAATGGCCTGCGTggcctccgtcttcttgaacttgggGTCTGTCGGGTCCAGCTGGAACTGCGAGCCCTTAG
CGTACAGCGCGCCGAAACGGGGATCAGCTGCGTCGAACGCGAAACCTTCCTGCAGTCCCCCGctcgccttctgcttggccaatttcttcatctccttAGC
GCGGCGCTTACCCTTGAGAgacttggccttctccttcttgacgatcttcttcatgtcgAAGTTGCGCTCGTCCTGGTCGCTGTCGTCCCCGCCGTCCTCG
CTGACGCCGCCGTTAATTGCTTCACGCAGTAAGTTGGCCTCCTTAGCACCACgccccttcttcttgagcacctcGCGCTGCTcccgctccagctccttct
gtcgcgtgcgcttctcgtgcagcttgcggttcttctcctgcttcttctcgcgcgTGTAGCGCTCGAACGGCGTCTCGTTCGCCTCGAGTTCCTTCTGTCG
CTTGGCCTTCAGCACGTCGCCAGCTCCTGGCGTGAACGACATCTCCATGTCGCCGTCAGCGTTGGctccgtcttcctcgtcgctgctggctccCAAACCG
CCTTCAGGAACGtcagcgtcgtcctcgtcctctgcgtcgCTCCCCAGCAGCATGGAACGGTAGCGgttccgcagcttcttgatcttggcctccttcttgg
ccttcttcttgctgtcagGGGCAGCCTCCGCTTTGTCAtcagcttcctcctcgtcgctgtcgctgtcgttctCCGCCTCAGAAGCATCCGACACGTCCGA
CGCGAGATACGccttgaagtcgtcgtcgtgggcGTCTTTCCAGTCCGACGGGCGCGTCAGCAGCTCTAGacgctgctcgtcgtcctcctcccACGTGAGT
TTCACGTctgtctgctgcagcgccaacgtGGCGAAGATGGCCGGCTTGTAGCGGTCAGGCACGCTGTCGCACGAGTCCTTGGGCGTGTTGGTGAACGCCG
TGTCGTCCGGCACGTAGCGAAGGTCAAGCACGTTCGATGACGTCTCATACTCGAGCTGGTCGCACTGGTCGAAGATGGTGCTGGCCGTCTTCACCGAGTC
GCACGTCACGACGGCGTAGTAGTaacgcagcttctgcagctcgtacttgCGCAGCTTTTCGCGGTCGAAACCGTCCGATTCGCCTTCGAGCgtcacgctc
ttcttcactccCAGCGggtcgtccgagtcgtacCCTTCCTCGCCTTCTGCGTCGCTGGCGGATTCACTGGCACTCTCCTctgtcttctcctcgtcctcct
cgtcctcttcaacagcctccggtttctcctcgtcctcggccgcctccttgtcctcctcgtcccAAAGACCTTGGGGTCcgtgctgttcctcctcTTTCTA
CACAGCACAACAAAAATGTTAGCAATTGAATCCATTCAACGAAGCAAAACGACTGGTACGCACCATCTTCTGGAGTCCGAAGTCCGACGGGTAAATCGTG
ACGTTCTGCACTGCACCCGTAGCAGGCGCGAACGACTGACAGAGAGCAAACAGGTCCACCGCGCGGATCCGCGTCCAGTCGCAGTTGAGCACAGCGAAGC
GTTTCGTCTCTTCGCCCATGGGGAtgtcctcctgctcctcctgaGCTGTAGCTTCcacctcttcatcgtcactgtcctccgagtccgagtcggagctgtC
CGAGCCCGACTCGAGCTCGCCACGTGCCATGCGGTTCAGGTAGTCGAGTCGcgagagcttctcgctgttcTTGGCGACGGTGGTGTTTGCGTCTTCGTTG
TCGTCATCAGAGCTGGTGGTAGACGGAGCCTTCGCCTTGGCTGCtgtttcctcttcttgctcctCTTGGTCACTGccagcctcttcgtcctccaaGTGGT
AGAACTTCTTGAGTtcgttgtccttcttctctatGCGACGTCCATACTTGTCGTATTTGCCCTGAACGCTCTGGAATCGCTCGTCCTTGAGCGCTCCAGC
GAAACGCCGGTCGATCTGCAATTTGCTTTTGCGCTTCGAGTTGCGCGCGAATCTCTGTTGATAGCCACGGAATTGCCACAAAAACGTCAGTTTGAACCAG
TGAATTGGACTGCAGTAGAGTGCCGATGCGTACGGGGTCATTGTGCACTTtctggaagcgctggtcgCGCACGGAGTCGCTCATGgtcgaaggtggcggc
cGAAGTTGAATCCGACGATGACAAGTTGGCTCGAGTCAATGGCGCTCGCTAGCTGGGAAGTTTCGACCAATGGGGTGATGTTGAAATCTGAGTCGAGATG
GTATCAGATCAGATATTCATACGGTCGTAAAATGGATACATGCACTTGACATGAAAACCTTTGCTGTACATATAATATTAATACGTGCTAGGCAGAAGAA
CAGTAGCTTCACGTTTTCCGTTCCACCGTCATAGTGCATGTACGTACAGCGTAGTGCTGATCGACCGAGGAGACTCCACTGGAGTTCACGGGGTGGACAC
GGTATGGGTTCGTCAGACACGACTGCTTTTTGCAAACTTTTCCTAAGATCGTGCCTGGAATTTTGGCTTACTCGATGAGAGAACAACTATAATACCTGCA
GTAAAACGATACATGTGTTTGGTGCTCTCTTACTGTACTGTGTCGCTGACACAACACTGTCAGTGGTGTTCTCttcaggagaagcagttTCCAACGACAC
AGCCTCACCGAGATGTTGCCTTTGCCAGAAATTGCAAAGAATTATTTCCTGTAACTTATTATACAAATTACACCTGTCTACAAGCAATGCCAACGTCTTG
TAACAACATACCCTCCTAACCTTAATAACTAAAACGCATTTCAAAACTGACCGCGG