Description :
From Genome Similarity Track
Location :
Scaffold_447:11269- 13789
Sequence
2520 bases(100 bases per row)
CAACGGCGTACGGGCAATCTTGCCGAAGGGGTACCTCAAACTCGTATGATTTTTCAGACTCGAGGTATCCACGCCATTTCACTATATACTGAAATTGACC
TTTGTGACGACGCCACTTCAGAAGCTTCTCCACATGGAACTGCAAGCTCCCTTGCTCGTTGAGCAACGCAGAGAGGGTCGATGTGTCGCACAGTTCATGA
GACTTGGTGTCAGAGATGAAGCGACTCCAGAGTCTTTTGCTCACGTGCAGACGGCACTGGATCAGTCTGTGACTGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCACTGCCGCTAAGTGAAACCATTTGCTTAAACGGTCAACAAAGACCA
CAAATCCCCCTAATGCCGTCACAGTCTTTGGGAAGACCGAGCACAAAATCCATACTGATAGACTCCCAGCACCTCATGGCACAGGTAAACTGGCAAGTGG
CGCAGCCGAATGTGCCGAGGGTTTGATCCGCTAGCACATTTCTCATTGAACGCACGTATGTGCTCACCCATTTGTAGAGTTTGGGCCACCGGTAGTGTTG
ACTTACAGAACCATAGGTCTTTTACCGGCCCAAATGCCCACTGAGGGCAGTATCGTGGACCTCAACGAGGATTCGATATTTTAGATTCTCATTGTGAAGC
ACAACAATCCGATTGGTATCCGCTACATCTGTGCGATAGCACAAGAGGCCATTATCGATGGAATATCAATGTAGGCTGGCCCGTAAGCGTGCCGATAACT
GACTGTCCAAGGCCTTGTATTCCTTACTCCCAAGGGCATGAAACAGTGCCACATATTGAGAATCCCGGGGATATGCCACACGATTTAACTTCTTAATAGA
CGACGACAAAGTCGTAACATGAGCAAGATCATAATCAGGTCGGCGAGAGAGGGCATCTGCCAACACATTTTGTTTGCCTGGATTATACTGCACCTCGAAG
TTATATTTCGCAAAGAAGGAAAGCTACCAAGCCATTCTCTGAGAGAGGTGAGATGACTGTGTCGCCGTGCGTAATGACGCATGATCTGTATCGACGACGA
ATGGCTTGGATCCGAGCAGATGGGCACTAGATTTGACGAGCGCATACTTCATAGCAAGTAGCGCTTTGGCACGAACTGGATATTTATTTTCAGCAGCTTT
CAGCTGACAAGATTCAAATGCGATAACTCGCTCGCGGCCTGCAGCATCTGTTTGTAACAGAGCGCTGCCTATGGCAAAGGCGGATGCATAGCAGACAACA
CTAAAAGGGTACTCAGGATTTGGCAATGCCAAAATGAGATATGGAGGAGACTCTCCTTTATTGCCCGAAGTGAGTCAGCATGGGTGTTGTCCCAGCGTCA
ATCTGTGTCCATTTCAAGGA