Description :
From Genome Similarity Track
Location :
Scaffold_912:11269- 12360
Transcript NameFunction/comments
g11116.t1hypothetical protein

Sequence
1091 bases(100 bases per row)
CTGGACCATACCAAGCAGGTCGTGCGCGGCCGCAAGGAAACTCAGCTTTACTGCGAGCTGGTGCTTTATCTGAGCGACTCATATGGGTGCCTCGTGAAGC
TGATGCAGTCACGTAAACTGGAGCGATACAACATCTTTGTGGTGATCATCCCACCCAATATCACCAACATCTTACAGCCGCTGGACGTTGCAGTCAATCG
CAGCTTCTAGGCGTACTATAGGAACAAATACGACGAGTACATCGGCAGCGTTCTCCAGGATACAGCGCTGCAGACGAGGTGGAAATCCCAAGGCCCCTAG
CTACAGTGTTGTTGGGCAGTGGACTGTCGATTGGATGACGACGCGCACTCTAGACGACATCAACAAAGCGTTTCAACCGTGCGGCTTAGTGCCGAAAGAG
ATAATCGAGGAGAAGAAGCTGCACTGACCTCTCCAGAAAATCCTTGCCCGGACTTTGACTCGGTACGCTGGAACGCGTCCTACCCGTATATACTGGAACA
GTCGGATGACCATGTAGCAGGGCTACACAGTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAATGGATACATTCAGGTTGACCACTCCACAGGGTGG
TCCACATTCATAGAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCA
GAACCTCTCATTAGAAATATCAGTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTTTCGTTCGGTTCCTTTATCTAGG
TTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAATGTGGTGTTGTGATTCA
CAAAAACTTCGTTAGTGCGGCTTCCACGCAACACCACAACAATTCGCCGAGTCAGGTCGGCGTTGTTGGGCTTGCGCAGGGTTCTGTTGGTTCCCTTTGC
GGTTCGGCCCAGCCGGGTCCAGTTGAGGCTCTGCTCTCGCTGAGTACCAATCCAAACTCCAGAAGCTCGCCTGAGCGGGGCAGCTTCCGTT