Description :
From Genome Similarity Track
Location :
Scaffold_1:112681- 117825
Transcript NameFunction/comments
g27.t1hypothetical protein
g28.t1hypothetical protein
g29.t1hypothetical protein

Sequence
5144 bases(100 bases per row)
CTGTGTCTCCGCGTTGGTACCAGCTTTCAGGACCTCGTCTCGATACCGCGGTGACTTCTCGTCGAGCTCGAAGCCATCCCAAAGGAACAGCTTCAAGAAT
GCGACGATCAACTTGGCGTTCGACTGCACGTCCTCCGTTGAGCTCCACACCCGCGGTTCCTGAGCGTATCAGGAAAACCAAGCATCTTTCAGGTTGGTAG
TAGCAGAGGTACGCCGACGCTTGGTTTGAGGATCGTTGCTGCTCGTATCTTCACTTGAAATCATTGCTCACGGAGCTTCTTGTTGTATATTGTGTACCTT
AGCCTCCATGATAAACAGCCGAGTGTCCAGCTTCAGGTTCACTTGAATTAATTGTTCAATCAAGGCTGCTTGTTGAAGAAACATGGGGTGTTTTGGGATA
GGTGCCGTGGTGTCTTGGGTGGTTGTATGTTTTGCTTCAGATGTTGCCGTTGCGTTCGAAGACAGGGACGACGACCACGCCAGCAGATCGTTGACAAAAA
AGTCTTTTTCAACTGTGCAAGCCTCGATGCGTTGAATTGCCAGTCCATTAGTGCTGAGACTTTTCAAGGACGGATAGTACCGCAGCAGATACGCCATGAA
AGTGTCGATGACGCGCGCGCTCAAGTTGTACGGTGATGCCTCCAGGACAGACGAAGCATTGAAGAGTGCTGCTGCTACGGACTGGGTCTTGGACTGGTTA
TCGGAATCGAAGCAGTCCAACGTCAGAAGACAAACGCTTTGTTCGGGGTCGAGGCCGCTCAAGACTCGTGCAACCCTGTGATCCTCGGCAGGAGTGTTGA
AGACGTACGCGAAGGCCTTGTTCGTCGCCGTCATGTTTCACGCTTCACGGTCGAAAATCCACTGCACGCACATTCCAGCTCCATTTGCATGCTAAGCACC
GCCGCGCCGAAAGGAATGCGGCGTCAGACGCTCGGCCACGCCAGCTTTTTTGGCGACTCTGTCCAGAACGCGATTGACGTAGCTGTAGATCCTAGGAGCA
GCATCGGCCGTCTTGCTCTCATCTGACTTCTTGGCCGTTTCGTGTAGCGGGATCGCAGCTTCCAGGTGGTCGATCAAGTCAATCAGAGGGGTAGCGAGTG
TCAGCGTCGCTCGGGAGACTGTCTGCGGCTCCGAAAGTTGGCTCAGAAGCGAAGCCGTCGGAGAAGATTGCGTCGCCAGTGCAAGCGCGATGGCGAGAAG
CGGACACGTGGAGAAGTCGTCGTCGGGAAAGAGTGAGAGGCCTTATTCTTTTGCAGTCTTAACCCGGATAAAACGTACGAAGAAGATGTCGCCTGCGCCA
ATGGACAGGTTGGCCTTGTGAAGCATCGTAAGATCCGACGCACGATATATCATCATCTGCTTGAGCGTGTTTTTCGTGCATGTAGGAGCCTTGTTAACAA
ACGTCCCCGGCTCTCTCTCTTCATACAGTACCGTTCCAGCACTTGTCCCTTCTTCAGCAGAATCTTGTCGATCCCCGCTCGATGCTGAGGGAACTGTTCC
AGCAGCCAGGTCTTGGCTTGTCGGTATTACTGCATGACTGAGTGTCGGACTAAGAGCTGGTCCTTGCTTGAAGGCGAGGTACATGCCCAACTTGTCTACC
ACAGCCTCCAAGACGAGTGAGGCACTCTCGCGCTGCATGCACACTCCCAAGTACTCCCAGCTGACGGATTCCTCCTCGAGAAACTTCAGGAACAAGCGTG
CTGCGCATTCTTGAGCCCGCTTTGTGTTGGCCGGCGCGAGGTCGTTCAGGCTCATGTTGGGTCGGAGATGTCGGAGCTTGGGTGCTATTCTAAGAATATA
CGAATGACTTGCAATCTGTAGAGGGATATCAATAACTTCTCTGCTCTCTCCGACACGATACGTCGGAGGTGTGGCTGTGGGACCTTTACGAATCAGCTAG
ATCTCTGATTGGTTAGAATAAATCGCACAGACTGATTTGATTCGTTATAAGTACAACAATTGTCAATCCATTCTTCCTATTGGTCGTTAATATACACAGT
GAAGTTAAGTGTGATCGGAGATTTGACGATATTCATCCATATCATTCAATGGCATACTGCCTCGTGGCATGGAGTCAGTGGTGTCCGCATGCATGGCAAC
GTCTGGCAGCAAGAGCTCAACAACAACGTGTGGTTGAGGAATGCCGTACATCTGTAGCCAGGCCGGCCACGTGTTGACGAAGTTAAATGCGCCTTTCTCT
GCGACGTTCGTTGCAATGATTCAGATGTTGGGCTGCAACCGCATCAGGGAATCGCCGAACAAGCTTATCGGCGTCCCCATGTGGTGCCTCAACGACGACA
GTGAAGCCAGAATAAGCTACTCTGGGATGTGATCTCGCCCTGCCATGAGGACTGCCGTCATGTGCTTCTAGTCTAATTCCGTCGTATATGTGCGCTCAGT
CATGAGATAGCGGGGGAAATGCTTCGTGTATCCATGATCCTGCATTTTTTTCCCGTAGCAAATGTAGCTGTACCATACCGATGATACATCTAGCTGTGTG
GGCAACTTTGACAAATGCATAGGTTGTCCCTTTCAATTGCGGGTCTTCCGATCAGTTACTTTTTTATGTTCTGGCAACATAATGTTTTGATGTTTTAACT
GAATTACGGATTGTGTCAACGGAAATCAATGCTGAATACATGTTATGTCAATAATAGAAATGGATACTTAATCTGTCAACCTTTGCGGTGGCAAGCATGG
CAGGCTCCTCCGCTCAGCTGGCCCGCGTGACTGACCGCTCTCCGCTCTTGGTGGCATTAAGGACTAGCAGCAACAATGGGTCATCGAAGACGTCAACACA
CATTGCCATCGTCGTGAAAATTCGCCCAAATTTGCTGCATTTTCTGGTCGATGGCTGCGTATGGGTAAGCTGGTCCACTTGAAATCCCATGGAGCTCCTC
TGATAAATCCTTACCATGGCTCAGTGCATTATCAGATCCAAGGTGCCGATCGCAGATGTCCGTGACTACCATTGCAACGAGTCTGAGGCTGGTGAAACTC
GCCTCAAACTCCTGGTCGCCGTTGCAGACGGGAACGTGTGGATCGTGACGTTGCCAGGCCAATTTCAGCCTGAAGTGGGGGAGATGACGAGTGAATTGGT
GTTAGAGCGCTCGTTTAATAGTGGGAGTGATGGTGGATGCGTGCAGTGGTTCTGTCAGGTTCCTGGAGTGCAATCGACTGAGCATGTGCCTGCAGGGTCA
GGACTGTCGTCTCTTACGCTGCTGAGAAGCTTAGTGACCCCGACGATGTTGATTGTGAGCACTCTCGGGAAATCAGAGTCGACATTGCAGCGCCACCAGT
CGCTGGAACTGGACGAGATTGAAGGCGAGCAGTCTACGTGCACATTTTGCTTGAATAGTCGAGATTTGAGCCATAGTGAGATGCTGAAAAAATTGTTCCC
GGAAGTGATGAACTACGCGGGCATGACAGCTGTACTGCAGGGTGATCTAGATGGTTGTGTGAGGTTCTCTTTGGTTCAGTACCCTTGTGTGAAAGGAGAC
ATCGCGAAGGCGTCAGTAATTCGCAGTGGTATCCTTCTTCAGCTGGATCAACCAGTTCAGATGATCGTTCCATTCTCGTCTTCTGTGTCACCTACACTGT
TGCCGGGAAACAACGAAGCAGTTCCTTCGTCGCTGGTGTTTAACACACTGTTGGTACTTGGTACTCGAGGGCAACTTGGAATTGTTGACTTAGAACGTGG
TAGCCCTGCTGAGACCCTCCCGGTTTCGGTGAAAAGGCTGGAGATTGGACGTGCAGTGCAATCGTTGACATTTCTGAACAGCTTGGCGGTGTGCATTTAT
TGCTCAAGTGGCTCGGCGTTCGTGTGTCGGAGCACCGATCTGCTTGCAAAAGCTCAGCACGCACATGCAGAAGCGAACGGAACGCTAAACGATGGCACTA
GAGTCTGTGGTGGCAAACTGCCTCTTCAACCGGTAAGTGATATCACGAACACAGCCCTGTCCGAACCTATGCTGACGAGGTGTGAAAATGTATAGGGCAT
CGTGCGACTGACAACACACGCGCAGGGGATATCAATTCTCTTTGCGTCGGGGCGCATCACAGCTATCAATGAAGCAGCTCTTCATGAAATGGAAACAGCT
ATGCTGCCGCTGCAAAGGCATCCAGGAAATCATGTTTACCCAGGATTGGCCGGTGGAGAACCTCTTCGCGAGTCTTGCGTCCGTAATCTGTTGCAACAGA
TCGCACAGATTTCCGATGCATCTGCTACCTTACGCACGCAGTCACAGCTAATGGACCACCAGCTTGATACTCTGCACTCAGCTTTGAAAATGCTGCGGCT
CGTGGATACGGCAGGTTAGTGGGCATAATACTGTTGATCGACGACCGATCGCTCGTTAACTTTGTTATGCATCTTTTACAGGTGTGGATTCAGTGATCAA
GTGCGAGTTGAGCGCTTCGATGATAGAAACTAGAACCTTCTCCGGCCAACAGACTGTCAAGTTGGTGTGTTCATTGCGGTTTGTCAATCCCGAAAGTGTC
ATATCACCTAGTAATTGGTAAGTCGCGCTTCAGTTCCACCTTTCAATTGCTAACCATACAAAGCCTCATTTCATATTATCACGGGCTACTTCCGTTTGTG
TATTTAGGTGGCTGTGCTTCTACGTGCGTATTAACCAGCGTGCAGTGACGACGTACTCATTTCCTATGAAGGATGTTTTCGTGCGTGAAGAGCAGAGCGT
CATTCTGAACCCGGACACAGTCGCTGCACAAGATCAGGGTTCTCTGTGGGTATCGTGCTCATTGGTGTTTTGTCCCCCAGAAAGCGGACAGCGAAAGACC
AAGCGTAACAATACGAGCACTCTAGACTTGAAGACGGCCCAGCGCAACAGCCCGTTGTCATTTGCGATTCCGTTGCTTCAAAGCCGGAGGTTCGTGCTTG
CGCAGCTGAGTCGGCCCATTGAAGGCGATATTCCAGTCAGTCAAGTTGCCATCAACGCTGCTTTCCGTCAAAATCAAGATCCATTCATGCCAGTTAATAG
GGCAGACAGCTCAAGCAAAACAGACAAAGCCTCATCGTCTGCACTTTGGGGCGGTGTCCAGTGGTGGGCTGCGCTGGCTGACTATGCCCAAAGCAACCCG
TCGTTTGCAGCTTTGTGGTCGAAAGTTGCGCCTCCAGAGGCGAC