Description :
From Genome Similarity Track
Location :
Scaffold_550:11268- 26003
Transcript NameFunction/comments
Phypl_g9333hypothetical protein
Phypl_g9334notchless family protein
Phypl_g9335hypothetical protein
Phypl_g9336hypothetical protein PHYSODRAFT_307605

Sequence
14735 bases(100 bases per row)
CTCTCACGTCGGCGATCGAAGAATTTGAGCAGTTTAAAGCTAACCAAGCAGCTGCGTTATCATTGGTCGCATCTCGAAAAGGAAGTAGTGAGCTCAAGTG
GAATCACACCCAATTTTCTGTGAGGTACGAAAGCATTGCTCAGGAGCTTCAAGTTGACCGATTTTACCTACGCGTGATTACGGAAAGGATAAATGATGGA
TCATTGCAGCTAGCGGAGGTGGCCAAGATTGTCCGTGCGATGGAAGCAGGAACGCATCGAGGAAAGTTGAAAAACTCGAGCAGCCTCTTCTTTGCTAGCA
TGGATATAGCGAAGGATCCAGTGAAGTTTTTTAATGAGGTGTACGAGTGTTGGTTGGAGCATCTTCACCTAAACAATATTCCGTTATCAGGAACGAACGA
TTGGTCTGCAAGTGGAAGCAACGGCTTCCCTCAATTTACTGGAGCAACTGGAAGCGAGCAACATGGTCATTCCATGCTTAAGATTCTAATAGAGTTAGCC
AACGTGTTCCCCGAAGCCCGACCGATCACGAAACACCGAGCCCGGTTTCTTACTGAGTTGTTACGGAATTCGTATCTGGCGAGTGAGATCCAAGATATCG
TGGAGTTGATGTCCGGATTAAGTTTGTCTGGCGATGCCTGCGCCGAGCTGTGTACGAAGCATCACATCCAAGTGTTGTTGTACATGTCGTTGCTGTCACA
CAGGCGTCAAACCACACCAATTAGAAGCGACATGACGAATGATCTCGGTGATATACCAATGATGGATTCATTCAACATGTCTGAAGCTAACGACACCTCC
TCCGTCCCAATAGCAGAACTTTCGCTTTATGAAGAATCAAGGTATGCACTCAAGTGGAGCATTAAGCTCCAGGCTGTTGGGGAAGCTGATGACGGCAGTA
CGATAAAAGGCTCATTTTCAGCGAACGAACTGAAAGAATACTTAGACGCTGACCCGTTCATTCGACACCGCCAGATCGACGCCCTGTAtgtttgttgttg
ttctATACATGGACATTCTGGTAGTGATGAACACGTATGGAAGTCGATGTTTGAATATCCGGAACTGCGATGGATGGAGCTAACCGACGAATCCATCGAT
ACAAGCTGTGCGGTGTTCGCCTTGAAGTCGCTGAGAAACTTTATGATTAAAGACCAACGCAAGGTAGCGGTTGGGAAGAAACATTTGTGGCCTCCCCCCT
TGGTGAACACCGTGGTGGCTAATACGTCGGCGCTAGCCTTGCTAgttcagctgcttctcgtaAATAACTCAAGCGTGCGGAGGTACATCTGTGAGATGTT
GATGTCTTTaaacgaagaagaactggaagagCTGTACAAGTATGGGGCCTTCTACTTCATTTTGTCTACAGTTTCGAATCCTAGAGGAACCGATAAGGTG
CCTGCCTCCGTTCCAGAGACAGCTCTGCTGAAACGTATCCATCGAAGTCAGCGGTCATCGGGGCGGTACGTGGGACAAAGCTACTTGACTGACATGCTGC
CCGAGTCGCTCATTGGCCTTTTGGACTCGGAGACCCCTGATAATTTTGCCGACGTGTATAGCGGCCGTAAGCGTGACAAGCGCGTCCTGTGGTCATCAAC
GATGAGGTTGCATTTGCAAGAGATGATGGATGAACACTTACGAGAGTTCAAAGAAAGTTTGAAGACGAGCGTCACAGCGAAGTACAGCTACACTCCTATT
CCTCCGATCTCTTACCTGGAATTGTCTGGGGATGTTTACTGCAGTGGCTTCTATCTTTCAACTTTCAACCAGTCGAGTTCTGATACCGAAGACGTGGAGG
ATCCTGTCTTTATGATGAAAAATATTGAAGAGAAGTGGAGATACTTGGCACGGCGTCAGGCGGATGGTATGGAGGACGATATGGATCATTCTGACGCCTA
CAAAGTCTTTGGCTGGAGCGAAGATATAACGTATTCATCATCCGATTTGCGCTCGCGCTATCGGGAGTTGTGTCAGCAAGAAGTCGAGGTGATCACAGTT
CGCCAAGCATTTGATTCTCTGTGCGTTGCACTTGAGCGCAAGAACGAGGCTAATGGCGAGAAAACATCGGGTGAGGTTTTCGAGCGTATTTTGAAATCAC
AACTGCAGTTGTTGGACAAGTACGGCTTTCAGTTTTTTTCGTACGAGTCTTCAACActtgatctgctcgtccgtgTGCTGTCGTCTCAATCGGCAAAAGA
GTCTAAATTCCGAAGCCTCGCGATGCAAGTATTACAACGCCTGCTCTCCGTTGCGCCCCAAAATGGGCCACTTTTGGTTACGATCGATGGTAGTTGGGAT
GCAGTTCTCGACTTGGTGGAAAGCTGCGCATATGGTCACGACGTGTCAGCGAAGGAGAGCATGTTTTCCATTCTTAAATTGATCCTCACCTCTGAAGAAG
GGGTACAATCGCTTCTAGAAGGAGATAAACATACGTCTAACGAGGTGCCGCCATCGAAAACATTCGACTTTAACTCCTTTCGGGACGAGGACAACACGTC
ATTTTTTACGGCGACGGAGTACGCGTCTCAAAATGGGGCAAGCAAGTCCATACATGCCCAGCGCGTATATTCACTGCTAGATGATGTAATTCTTTCTTTT
GAGAACATTCAACCGTGGCATATCCAGAAAATGTCGTTTGAAATCGCGTCATCACTTTGCCGGAGTCGTGAGCTGCAAGAACAAATCATGTATTCCACGC
GGGTATTTTGGAAGGGTCTCTATTTGATCTTAGCGTCAGCCGAGAGTTCGTCAGGACTTGATACAACACAGGATAGTACTACGGCGTTGGAGAAGCAAGA
GCGTGATATGTTGGAAAGTGCTTttggagctcttcgatcGTTGGCTTTGGGATCGGACGGCACCAGCCGATCAGCTGGGCTTGAAGCTTTAGCAAATCTC
CTCCCGATGGACTTCTTGGATCGTCTCGAAAAGCCAAATGGGTACGACTTCTGTACCATTTTACTGTCAGATATTCGTGAGCCGACCTGCATCTGGAACG
AAAGCACCCGGGCCGAACTCTCTCAACTTACAGAAGAGTTTTGCACGGATCCTAATGGTGACGGGGTATCGTTTCTGGAAAGCGCCGCCAGCCACATGTA
CGATTGCCTCAGCTCTGAGCCGTTTGTTGGAGGGATCTATTTGCTGATTTTGCTGGAAAAGTCAGAGGAGGATTCCCAAGCAATCACGGAGGATACCCTG
TATCCGACTACGGCGGTTGACTTCGTAGAATCTCTCTTTTGTTTTCTGAATGAAAACAGAAATCCCAAGCTGGGCATTTATTCTGATACAATGCCAGCTT
TGGACTGTTTAAGTCTTCTTTGTGATTTGTCAGCCTTCCGACCCACTATTGTGGAGTGCTTGGAGCAACACGTTGATGATGAGGATGCAGTGAGCGCCTC
AATTTCGGTGGCAACGCTTGGCAGATATTTGCTGCCATTTGACGGTGACGATAAAGCAAAGGCGGCAGTATCAATTTCGTCGCGTAGGTCACTATCGACG
TATGGATTTAAAGCCAAGGCTGAATCCGGCGATGTTCCTTCTGTGATGGAATCCGAATTTGGAAATGTGGATTACTTAGCCCGCCAAGAAATGGCACTGC
TTATCCTGAACAAAATCTGCGGGTTTGAATGCAACTTGGAGCGGATGTTAGCACCTTTCTGCCAATTCACATGGTGTCTTCAGGTTATCACAGATCATCT
CGGATACGAGCAAGCCTTTTATGCGCTCTCGTGCTTGGCCGAGTTGTGCGACACTTGCCTAGTAATTGCCGAGTACGTGCAAGATAGCGGTCTGTGGGTT
GAGATCTTGGCTATCGCGCTCCAATCGAGACAGCATGTTCTCCATGAGCACTTCCTCCGAGCTGAAGCGCTGCGGGAACCTGCATTCGAAGTATTGTACG
CGTTGCTGATGAAAGACTTAACATTGCGAGAGAACATGTACAGCGGGCTTTGCAGGTTTCTTCCCTACCCGATCGTGTACCAAGTTCACCTGGATCCGAG
CAAGGCAACTCGATTCTTCGATGACAACCACGACAAGAGCGACTTGATTTGGAATTCCCACAAACGAACAGAAgtgcgcaagaagctcgaccAGATCATT
TGTCGGAATCGGGTGGAGCGATCAGTTGCAAAGCGAGATTCTGTGCTGCTCGATGACGAGACAGATTTTATCCCGTACCCTCACAACTTCGTGGCGGGTC
TGTACATTGATCGATTCTTGTCTCGACCAGATCCAGAGAAGCTGACAAACCCAGCATATAATTTGGAGTTGCTTTTCCAATTGTGGAGGACTCAGCTTGA
TCAACTGATGGGCTTCAATCTACAAAATCCCCCGGATAACCTCAAGAAAGTTGCCGATGAAATCGACAAGTATACCATGGCAATGACACACATTTTGCGA
GCGTCGCTTGACATAGACGAAAGCATCGCTAACAACCGCGTACCAGATCACATCGTGAAGCTGGTACGCCATTGCAATCAGCATCTGATCACCAGCTTCC
CGTACCGCTGCGTTTTACGTATCGCTCGACGTTTAGTGCAGTTCCCAGAGATCACCTCCAAAGAATTTGTGGAGCTGCTTATCTGCCGAATCACGATGCA
GCACCCGGACATTCCATCGTTGCTAAAGGTCCTTCGTCGTGTGCTGGAGGCGCGTAACACTGTATTGACGGAAAACGGGACGAACGATGATCCAGAATAC
TGGTTAAAAGACCTCAAGTACTATCCTCAAATGCTGACGTTCCTGGAGGGACTGGTGGAGAATAAGGAACAGATCGACGCTCCTCTACTTTCGAACGTGA
ATCGCGTGCTACGTATCATTCATGCCGAAGAGCCGAAGGAGACCCATTTGAAGCAGATATCCCGTAGTTTCATGGGACGCTGGCACAACTTCACGCTAGA
AAGCAGGCCATCGATGCTCCGTAACTCAGTCAAAACTGGACAATCCGAAACGAAGCCGCCAGCGACTACAAACATCGATTCGGTCGACCCGAGCATGATG
AACACGCAAAGTTTTGACGTGGATGGAGCAAGAGCGATCTCTGAAGACGTTGCGAGTACTCGGAGCTTCGACGTGGATGGCGAGAGAGAGCCTTCCATCC
GAGTCGATATCAAGGGCATTCCTGATGACCGTGAAGTTGACATCGACGGCACATTCATCCGAGCACCTCCGAAGAGCATCAactttgctggtggtgctaT
TGAACTGACAGAAGCTGTCGCACCTCGCAGCTTCCGGTACAAGGGCGAGGTCGCGCGCAATTCCCCGCTGCCCTCTCCCACGTCAGTCCGCTATTCGACG
CTAGGAGCTCGATACGAGCCGATTGACTCGCAATATCACTCCACGAAGGCAGTCGAGTACGATGAGcacgaagatggcgaagacATCTTCACCACTCGGC
CGCGACGTGGGAGTTTGCCATTGAAGCcagacgacgtcgacgtgaAGAGGGTCAACGGCAATGCAATCACTTCGACTGCGGCAGGCGACATCCCCATGAG
CAGCATCAACGTCAGCAACTTCATATCGCAAGCGCCAACAACCCGACGGCAGTCTCAAGCGACGGCTGAAGTTCCGTCGGAATCGACGACGTATCTGAGT
CGACAGAGCGGGATGAGCGGCACGAATTCGGAGCGACGCTACTCTCTGCTGGACTCATGGAAGGCTCCGAcctcagcagcaccaaacTCGTCGCTGACGA
CGCTCACCATCTcccgacgaggacgccgagctgctgctgtctaCAGCCGCcacaagtccaagaagaagagatGGTTCAACAGatagttgaagtgctcgat
CATATTTTTACAGAGTCGTGGTCCACCCGATGAAGCTCTGAATTTATATATATATATGATACTGTACTGATAGTGGAAATGACTCTAAGAAGCTTTTGGG
CGGCATCTCCTGCTTTAGTGTTATAACGATGCCGGTCGTgccaatacatgtattgtgcctttcagTACTgttgtcgttttcacttgGCTGCATCCTCTAT
TTATATTAATTCAAGGTggttttataaatcgaggtaTATCtaaagtacaaatcgatctACTTAGGGCAGTTAATATCGGATAATTATTCCTTGTTACTAT
AGTATATTTTTTGGCAGGGTCATAACGGCATGCGCGGCAGTGATGAAGTGGTGAACGCGGGCACGAGGTCGAGCAGTCGACACCGAGAATCGACGAGGAA
CTCCTTCGCAGCAGCCCGTTCGACGTCGTCCTGGGTTCTCCCCGGAGGCTGCGCTGCTCACGATTCTGACGGTGTGGTGGCTTTCGCCATGGCATATTGC
GTTGGTGGGTGTACGTTGGTATGGTTTTATGGTCAGTCCGAAAAGTTTGATGTATTTGCGGTCAGTGCCACCGCGCTGGCTCAAGCTTTACAACATAGGT
TCTCTGGTCTTTCACGTGTTACTGTAGGTAACACTACGGTCAAATACATGAATTGCATATAAACTGGTGGGCAGAGAAGAACTCAATATACGAACATGCA
CTTTAGAATTACTAATTAAAACcatccagctcagcagctcgcaggACTTTCAGCTCTACTCCCGggactgcagctcctcgttgcACGAGAGACAGAAGAC
gcggtcgagctgctcgtcgcaGTTGAGCGTCGAGCACAGCGAGCAGAAGACGTTGCAGCAGGCGTCGCActcgcggcggcagcagttGCCCATCGCCCGC
TCACagtggctgcagcgctgcatctgGCTGGCCACGAACTGGTGCTTGGCGCTCTCGCAcacggcgcagcaggcgcgcggCGCCTCGGTCTTGCCGGCGA
ACAGCTGCccgatgctgctgtgcttcTTAATGCGCGCGTTCGTGATGGCGGCGGACATCATGCGGCTCAGCGCGTCTGCATTCGAGTAAAAACATTTCGA
CTGTAAGATTCGGCGTTAAAACACGGTTTTAACGAGGGTTTTAACCACGCACCGACGGGAACGGAGCGGTCTCGGCAGCGCTTGGCGGACGCGTGGGGCG
CCTTCCAGGGAGACATGGAGGCCCACAGagccgacggcggcggcgtcatgcCCACGGCGTCCATGTCGCAGTCCTCCGTGTTGCTCTCGTCGCGGACGCG
CTTCATCTCGCGCTGGGCTGATTTTAACCGTAAAGGCAGAGAAACTCGTACGCAAAAActttgaagctgctggccgcgcgcTAAAGCGGAAGTGAGACGC
TGATGGCGGGAGAGTTTGGCGCCTATTCATTAAAGTACGAACCATACAAAGCCTACAAACATCAAGTGTAAATCGAACTCTATTGAAAAACTTAGtgctt
ccagctgcagagACGACACAGAAACGAGGGGGAGTTAGTGACCGTACAACTTCAACGGCAACAATGGCCACGTACATCTTGATGGTGCGGTCCTTGCTGC
CCGAGGCCACCGTGTCGCCGTTCGGGCTCCAGTCCAACGCGTACACCTCGTCGGCGTGGCccgacagcgtcgtcttggcgTTCTTTGGCTCACTGAGCTC
CCACACCTTCACGGTCGAGTCCTTGCTGGCCGTCACGATCAGgcgcgagtcgctggaccagcacaCCTGGTAcacggcgccgacgtggcccGTGAGCGTG
GCAATGAACTTGCCTGTCTGGCCATTCCAGATCTTGACTTtcttgtcgaagctggcgctggcgaagtAGCGTCCGTCcggcgagaagctcaagtggTTCA
CGGGCTGCTGGTGGCCCGTGAGGCgcgccagcggcttcttgctCTCCGAAGGCTCCCAGAAGAACAGCGTGAAGTCGTCCGAGCCGGAGACCAATCGCTC
CGGCTGTCCTTTGCGCACCTCCTGGTACCGCTTCAGTGCCGcctcctgcatctcctcGCGCGACGCGAAGCTCTTGATGTTGTGGCTGAACGGACCCGAG
CGGCAGACGTAGTCCAcgttcagcgccagcgtgttGATACGGTGACCGTGTCCGATCAACGTGCGCACGAGCTTGCCCACATGCTCGCCCTCCATCGCCC
AAACCTTAATGGTACGGTCACGCGACGCACTGTACATCAAGCCTTCACCTCCCCACTTAACGCACTCCACAGAGTCCGTGTGGCCCGACAGCGAGGCGAT
GGATCGACCCGTACGGGCGTTCCACACCTTAATCGATCCGTCCTTCGAAGAGCTGGCAAAGCGTTCGCAGGTGGCATTGCGGTGCATGGGCTCCCACGTC
AGCGAGTTCACCCACTGCTTGTGGCCCTTCATGGGCTGGCCGATCTGCTTGCCCGTGAGCGGGTCCCACAGACGAATCTCGCCGTTGCGGTCCGCCGACG
CAAAACGCGTTCCATCGGGCGACCACGCCGTGCACAGCACGTGGTTCTTGTGTCCGCGGCCCGTGTGCTTGGGCATGCACGTGTTGGTGTCCCAGAAGCG
CACGGTGGCGTCGCCTCCTCCGCTCGCCAGTCTCTTTCCATCCGGGCTGAAGCTCACGTGCAAGATGGCCTCCGAGTGTCCCTGCAATGTGTCGCTGCAG
CGGGTAACCGGACGCACGCGGAAGGCCGCCAGCGGCTGGAACGTGATGgtcagcgccgtctccgtcgacAATTTCTACCGCAACATCGTCAACAACATGG
TCAGGACTCCCCTCTCAACTAGCAGCAATAGATGCCCGTAGTAGGTAGCAGCCacgcaccagctcctccaccgtgGCCTTGAGTGACGTCGTCACCTCCG
TCTCGCCAATGAACAGCGAGTACGGCACGCGGTTCTTgccgttctgcagcagctcgttgaccagctcctccatctggCGGACGTTGGAGCTCAAGGGGAT
CTCCAGTTGCGGCCCCACATTGGCGCCCTATCCGAATGCAAACGTAAACCAACACAATTAGCGTCTGCAGTAGAAGCCCCGAGGTGTCAATGTGTCAACT
GTCGCACGTCTTCGCTCTGGAACTGGGCGATGGCGGACGTTCccgtctcgtcctcgtcctcgtcgctaGCGTTCGGGTCTTCAGGCTTCATGGCCGCGTC
GGCGGTGTgggcgatgctggagctgatggGCTCGTGgtccatcttcatcttcttggcgacgtGCGTGGCCATGGCTGTTCAAAATGGTGAATGTGTCAAA
AAACTGTTGGCTGCCGCGAAAATTCGAATTTTGGCCAATCGGCAGCTGCTCACCGAGTTGAAGTGAACTGCACCAATGTATCGTGATGTAGCATGCGTGA
ACGCTCGCTACTGAACGAATCGAAAGCTACGAAGCAACTGGAGATGTCGGTGTTTTTCGCATTGGGTTATAGACTCCGTTGCCTAACCTGCCTTGTAGAT
CATGACTGCTTTCTCGTTGTAGTAGAAGTAGACAAAGTTCCTCGTCACGTGCGTCACGAACGAGCCAAAGTTCCGGCCGATGCACACGACCCAGTGCGGG
TCCCACGCCTCATCCAGATGAGCCTTGACCTCCTCGCACACCTAACAACACCCACGCACAGCAAACGAACGTCAAGAGCCACATGTACCGAATAGCACAG
ACGAAAACGCGGTAGCCGCTGCCGCACTCACGGCCAATCCGTTCTTCTCCCACTCCTCGGtgtcgtacttggccagcCTCGACGTGACGTGCTTGATggc
gtcttccagcacgtcgtcctccatATCGCAGGGCATCTTGACCTTGGCGCCCCACATGTGCTGCCAGCTCGGTGCCTCCCCCATGCTCGTGGGCAAGGAA
GGATCTGATATTGACGCGACGTTTCGTCGGGTTTCCATCATTTCAACATGGCTACGCTTTAGGGGACGCGAAACGACGTGGTGGGGAACTTTGGAACGTA
CGTGGGTCACTCCACGATGGCGAGGCGGGTAATGAGCAGGCGTGgcaacagcgccagccagcCGCAGGTGACGCCGTATCAGCAGATCGAGGTGCAGAAT
GGCGATATTGACGTGGTTTTTGCATTGGAAATGAGTGCTCACCGcttggctgcagctggacgatgGCTGGCGGGAGTGGGAAAATAccaagcaggagctc
gtgctggtgaAGAGGCAAGTGGCAGAGAAGGTGAGCTCCAAGATGCGTTTAATAGTGTACTGCATTGTGCTGTCGAGCAATCTAACGCGGGCGGTATCTT
CCAGGATGCACTGATTCTGCAGCTGAAAACTGCATCTCGCAGATTACAGGAAACGCTGCGCAAGAAAGATAAAGATGTAGGACGATACAATTCGGCTGTC
ATGACAGACAACCGCGTGGCGTCTTACGTGTGTCGCTTGTGTGTTTCCTGCTGGGGTATGATTCCAGTTGCAAGCTGCGTTTGCTATCCTGCGGTGCCCA
CAAGACGCCAAGACCACCAAAACCCgcaagcaggagctcgtTGACCGTCTTGTGTCGGAGTGTATGCAGAGGGTATGGCTATTCTACGCTGAAAACTACT
GGTCGTGGTAACGGGACTGTTAGTGACGCGCTGTGGGTCTGATGTCTTCGACTTTGGTTAGATAGGCTGCGACTTCTGAAATTCTAGCAGAAGAACGAAG
GCGAGAGCTCGACCGCCTAAAGTACAGCAGGTAAGCGACACTGGAGCACTAACATTTTGGTTGTACTCTGTAATTGTTCACTCACGCGTATGGTAGTAAA
TTTCTTCGcttccaggagctggagattGAGATTGAAGAGTGTCGtacggagatcgagcgccTTCGAGCCAAGTTAGAGACTACGTCGGTACCCTCACCGA
CTGCAATTGTAGGGAAACTAAAAGTTTCGTCTATGCCCCTGACCGGTAATGATCCTGGAAGCATCACTGGCGCCTTGATGAAGAAAACCAAGCTGGATCC
ATTGAATCTGCCAGGAAATGAAAGCCCAGACAGCAGGCAAACCGCTAATGTTCCCGCCGCTTTGAGCGCGACCAGAATTCACGCCACACAGAGTACCTCT
GGGCAAGTTCGTGTCGTGCCACTCGCAAAGTATGACCATCGAGAGGGTTTTGTCTCTAAAAcgcgtcgacgagctcttgAAGCCGAATATTACAAGCAGG
TTCGTCTAGCTCAGCTGGAAGTCGAGTGCGAATTGGAGGAAAATTTGCAcattcgagcagctcgtgagGCCAGAAAGCTCGAAGCCATTGGTCATCAAGG
CAGGCAGACAGAAATTGCCATTGACAGTGGAAGGTTTCAGCAAGCGGCTCCCGATGTTACGCCAGGTAACAATGACCCGTCCAAAACGCCGGGTGCAGAA
GGAGTTGAACGGATTAATGCTCACGATGACTCGGCTCATGTTGATGGTGACTCTGGCGGACTTGGACAAGAGGAAATACCGTCTCAGCAAGTACATGATA
ATAAAGTACAGAATGCCGACACGACCGAAATGGAGGTTGCTAAGATTTCGCAGCCCAGTGAAGTTAATGCAAGCGAAGAGGGATCAGCTGAGAGCGTTGA
GCAAGCAGAGACTGTCGAACAGGGCGTGTCGGAGGAGCCAGTAGCAAGTACCACAGAAGAAATGactgaagaaggtggagggCATCAAGAAACAAACGGA
CAAGTACAATCCAAGCAGAAGACGTACGAGGATGACGAATTTGATGCAAGTGACGATGATAAGAATGACAATATCGAGGAAACTGACAGCGTCTGGAACG
TGGATCCGAATCCGCGAAACAATGACCAACCTGACGCGGTGGAGAGCAACAGTGCCGGGCTGGAACAACCAATCGGAGCCACTAACAACACAGAATCTGC
AGTCTGGAATGCTGATCCCAATCCCTTAGCCTCCACTGAGACAGAGTTTCGAGGTGAAGGTGGTGCAGATAGGGTGGTTTGGAATACTGATCCTCATGCT
GCCGGCTCAGATGTTTCGCTGGACGATGCACCAATTGTCTATAGCGACAACGAAGATGATGTACACAACACTGCAGTAAAGCAAGAGGATTCAGTCCGGA
GTGACGGCAATAGTGTCTGGAATTTGGATCCGAGTCCTACCGTTCCAACGGATGAGAAGCTCGCAGACGCAGTGGCGTCATATGAAGGAGAAGTGCAAAG
TGGAAAGGAATCAatgcaagaagaagaatcGAATGTCGTAGATGACAGCGGGGAGAGCAAGATTTGGAATCTAGATCCGACACCAGCGTCAGGTCCAGCT
CAAGTAGCTACAACTATTGAAGACGTTAGCGATATTGAACACCCCGCCGAAGTGATCCAGCCAGTTTGGAACCTAGATCCTGAGCCTGCAGCTGAGGCAG
TCTCAAGCCCGGAGTTGCCACCCGCACAAAATGACGCTAATGAGGAGGTACCAGCAGAAACCTATGAGGAAGAAAACGCTGATGCAGATTCCAGCATTAG
GGAGGATCCCAACCCGTCGATTGCTATCCATGCTACtgacccagcagcagagaaAGAATATGGCGAAAACCCCTGGAATTTGGACCCCAAttcgtcgcca
tctcctACTTTAAAtaacgacgatgacgataAAGAACCAGTGCAATATGCAGATGTACCTGCgcacgacgaagctggtgctggtgagTTGTCTGCTGGTA
CTGAAAATGCTCAGGCTGAGCCTGATCGCGACGTTACGGATAATGAAGCAGACACGAACAGTGCTTGGAATCTAAATCCCAGCGTACCTGTGACCGCCCC
AGAACAAGTTGATGAGGGAGGGGGTTCTCCCAGTGGggaagaagaaagcgaaaCGAGTGTTTGGAATTTGGACCCTCACAGTGGAGATGCCAGCGAACCG
ATCGACTCTGCCACCGAAGTTGCAGCTACAGAGTTTGAacaggaggacgagaacgttTCAACCGTTCAAACAGCGACGGCTGAAAACGTTAACGATGGCG
GTGGGGAAGGCTTCAGAGACGAAAGTGGTAAACCTGCCGAGTCCTCCAACGAGCCAGAGGCGCCTGCTTTTGACGAAGGTGCAGGGCCTAATGGCGATAT
GGCTGAGACAGAGCACACCACTGAGGCAAACAATCCGAGCTCCCCTCGAGAGTCCGAAGACGATGCCACGCCAGAATACACGCCGCCGTCAACTGCACGC
GACTcagacgcagcaggagacgacgacgacgacaccacATGGTGATACCACTAGCTAGCACAGCAAACTTCAATAGACCACGTCAGAATGGTACACTGTA
TCCACCCCActcttcaagcaacattccCACAACTTTCCTCCATCCAGTCGTCAATTTTCGCCATGATCGCCTGCGTCGCCGTCATCGGCGCGGCCGTAAG
TGCTGCCTGCTAATGAATGACCCAGCTCCATAGACTAATAGCGCTAATTCAATGCATCGCTTCCTCGCCGCGCAGAACAGCCCCCTGTACATCCGCACGT
TCGGAGAGGAAGGTGAGGACTTGGGCTTCCACTACATTGCGCACGtgtcgctggacgtgatcgaggagaagctgcgggGCGCGGGCATCACCACGTCCAA
GGACGACATGTTCCTGGGCTTCCTGGGGCCCATCGAGGACTACCGCGTCTACGGCTACGTGACCAACACGTCCGTCAAGttcgtcgtggtgctgcaggac
gcgccCGTGCGCGAGTCGGAGCTGAGGCCGGTGGGATCAACAGCGCCAGTTGATAGCGAAGGGGGCCTATAGTCTGTCTGACTGACTTGTTGCTGTGTCT
ATTGACCGCAGTTCTTCGCAGAGGTGCACCGCCTGTACGTGAACGCCATGGCGAACCCTTTCGCGCCGCTGGGCGAGCGGCTCAGCTCGCAGACCTTCGA
CAAGCGAGTGTCCAACCTCGTCGTACAGCACAACACGGGCAGCTAAGGTGGAATGGAGTTTTTATCTTTGCTTTGTGCATTGTATGCATTTTATCTCCTG
ACAGAAGCGCTCGTCCTCTCACATACCCAAAGCTTCGACTGACAAGTCGCCCACCccgctgtcgtcctccttctcctcctcctcctcggaaTCGGACTCC
TCGTCCTGTCCCTCTTCGTCGATTTCGGGCATGGGAAAACGCAGGATGGCAGCGATACCGCTCACTTGGCCTAGCTTCTCGCCCGACACGTGCAAGCTAC
TGAACAGCCGCACGGTGCCGCCGTTATCCCGCACGCTTTCAACCAGGTCAACGTATTTGCGGCGCGTAGCGACATCCTGCGCCCGGAACAGAGCGTCCGT
GATCATGAGAGTCTCGATGGCCATGTTTTCGTTGGCACACACTACGTGCTTGAAGCCGTAGTATGCACGGTCCTGGTCGATATGCAACATGTTGAAGAAG
CGCTCCAGGCACTTGACGTCTTCCACCGCCTTGGTATCCGCCACCTGCGACTGAATTGCCGGGTCGTTAAGCACTTCATCAAGTGCGTGCTTGTGCCCAG
ACGACGAATGGCACGGCACGAACTTGGGCTTGTTCTCAAGGATGAGCTTGTCGTCCTGGCGGACAGCCTGCTCGAGCATGAATTTCAAGAAGTCGTCCTT
GACGAAACCCGGActcgcaagcagcacgcactTGACTAGCTTGAAATCAATGTGCTGTCGAATGGAGCGCACAATGTTCTCATAAAATTTCTCCGTGCCC
TTAGCGTGAGCCGAGCTTCCAGGACGCTTCTTGGGTACACTCGTCTCGATCTTGGCACGAATGACAGTCATGTCGCCTTTGATCAGACACAGGTGCGCCA
GACCGACCTGCATCACCACAGCCGCCAGCTCAGCTTGCTTGGTGATATCACAGGCCATATCGATACGCTCCAGCGACATAACgtcccagcagctcttcgc
caGCGTGAAGTCGCGGTTCATCTCGAGATCCAGCG