Description :
From Genome Similarity Track
Location :
Scaffold_374:11265- 12336
Transcript NameFunction/comments
Phyke_g9679Avr4-associated TDF-like protein

Sequence
1071 bases(100 bases per row)
CTACAAACCAGGGTACAAACCGAGGAACCCAGGAGTTGGCTCGCCCTGCACCTCGCCGAAGTACAACGCGAACGTCTGACGCCACTGCTCCACAGACTCA
CGGTCCGCCATGAATTTCGGGAACTCGTCCACGTTTGCCTTGCAGATCTCCCACGGGTGACTCGAACCGCCATTCGCAGCTAGGTCCACACGCACGTTCT
CGGCCACAACCGTCTTCTGCACCTCCTCCGAAATGGCCCAGTTCATGAAAAGCTTGGCGGCCGCGGGGTGCTTGGCCTTGTTCAGGATGGCGATGCGCTG
ACCCCATGCCAGATATTCGTTACCGTTATCCGTCACGAAGGTCACGTTGGGTGCTCCCGTCGTGTACGTTCCAACACCGACGACCTTGTCCTTGGCCACA
ACCAAGTCATTGGCCGTGTTGGAGCCGCGGCGGAACGTTACGTTCTGGTTGGCGAAGTCCTCGACCCAGTTCCAGCCGTATTTCTCCACGTAGAGCTTGT
ACACGAAGAGTACAGCGTCGTCGTCCGTCGGGTGTGTCGACGCGATCTTGCCGGTCCATTGCGGCTCCACGAGGTTGGCAGGGGACACGGGCGCTGCGAC
ACCACCCAGCACGCTCGAGTCGTACAGGAAGCTAAAGGTGAACATCATGTAGGCCATGTAGGCACCACGTTGGTCACGGAAGCCGTCATAGACCTGTGAG
AAGTTGGCCGGCTTGTACTCAAGCAACTTTCCCTCCTGGGCCCAGCGAGGGAAGTCCTGTAGCGtctgcagcgccacgagGTCGGGCATGAGTGTGTCGG
TCTCAAGCTGGTTGTCGATGCGTACGTTGTGGTACTTGCTGTAGTCCACGATGAGTGTGAAATTAATTTCTGGGAAGGCGGCCGTGAAGGCCTCGTGAAG
CGATTCTTGCTGCATTGAGAAATCTCCACCATGATACATGACGAGTTTACCGCCCTCGGTGATGGCGTCGGCATAGAGTTGGTCGATAGACTTGGTCTCT
TCCTCGACCGCGAACGCGTAAGTGGCGAGGAGCGCGCAGCATGCGGTGGTGAATGTCGCGAAGAATTTCAT