Description :
From Genome Similarity Track
Location :
Scaffold_614:1126- 8452
Sequence
7326 bases(100 bases per row)
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCATGTGCCGCATTGTTG
AGTGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGATACCGTGGAGCGTGTCGTCGAGCACGCGATTGACGTGCTCCG
TCTGGCCATCCGTCTGCGGGTGGTCCGCCGTCGACATCGACCCTCGTGTGCCGAGAAGGCGAAACAGCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTC
TCGATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCATGAACTGGA
GCAAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGACCGGAAGTCCGAAGACAAAGTCGAGACTCATCG
ACTTCCAGCAGTCCGTTGGGACCGGCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCACGCGCTGGCACGTCTCGCACGTACGGACGTAGGT
GGCGACCCACTTGTACATATGACGCCACCAAAACATCTGCGAGACAGACGCGTACGTCTTCTCACGGCCAAGATGGCCACTGGATGGAGCGCCGTGCGCC
TCCATCAGGATGTCGTACTTGAGATCCTCGTCGTTGGGCACGACAATACGGGGAGGATCCTCGGGCTCGACCCTATAGTGGAGCAAACCGTCAGCCCACT
CATAGCGGTGCAGCCTTGCACGTTGTCGGGGCGTGAGCCACTCGGCCTTGGTTTCCGAGCCAGCGGCCAAGAACCGCACAAGAGGTCCGAGACTGGCATC
GTCTCGGTACCCCAGCCTGATGCGATCATACAGATCCGTCGTGACCCGACTAATATGAGCAAGCTCGTAGTCGGGTCAGCGCGACAGCGCGTCGGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACCCCGGCGCTGCTGA
CGATGCAGCCCAGAACCTTGATCTCCTCAGCTGCGAACACGCACTTGTCGATGTTGGCGTACAGCTTGTTCGCCCGCATGACTTCGAACACACGTCGAAG
GTGCTGGAGATGCACCTCCATGGCCGTCTGGCCTGCCTCGGCACGGCTGTGGACGAAGATGTCATCAAAGTACGTCTGTGTGAACGCACGCAAAGGTCGG
AACAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTTAGAAAGACCCTGAGGCATGACCAGCCACTCCCAGAGCATACCGCTTGGCGTGCTCACCG
CCGTGAGTGGGATGTCGCTCTCGCGCATCAGGATCTGGTAGTATCCGTCCACCAGGTCCAGCGCGCTATACAGCGTGCAGCCGGCCATGTTGTTGAGCAA
CACGTCCTTTCGCGGGATCGGTGTCTGCGCAGGCACTGTCGCGCTGTTCAGCTTGTTATAAGCATGAACCAGACGCCATTTTCCGTTCGGTTTGCGAACA
CAGAAGGTAGGCGTCGAGTGCGGGGACTTCGAATCCCGCACCATGCCTGCCTTCGCCTTGGCGGCAAAGAAGGCATCAATTACTTCACACTGCTCCCGGG
GAAGAGGCCATTGCCTCGTGACACAGTGCTTCGTGCCCGGCACGAGATCGATCTCGTGCCTGATTCCCCTGTCCGGAGGGAGATTGGACGGTGGATCCTT
GGACACCACGTCCTCGAACTCCTTCACCAAGAGGTACACCGGGTCCCGGGGGTTCTTAAGAATCTCAGAGCCCATGCGCGACGCGCGCTGTCTCTGGAGC
TCCTCCAGGACTTCCTGGTCCATGACCGAGGACGAGTTCAACTCGGCCAACGTGGACTCCGGTCGGAGGAGAACCAACTCTGCGATCTCCCCGGCCTTTA
GCTCGGCCAAGAAGTCCTCCATGGCGAGCTCCTCAAGGTTCAGCAACTCTGAAACCTCGGGCAGAGCTGTAAGATCGACAGCTCCTGTCTTGACCCGACG
ACCGGTCACGCCGTCGAAGATGTGATAACACTCTTCGGCGGCTGGAGCCTTGGCTGGAGGCTCGGAGTCGCTGGCGACTGGCGTCGTCGGCCACACGACT
AGGCCCGGCTTACGACGTGACCCTCGGGTGTCTTCGTCTCGTGGCGCCGCCTTGACGGCACCACCGATCTTCTCGATCTCGTGCGGAACTACGTTACCCG
CCTTGTCCTTGAGCGGAACTTGGTTACCCGCCTTGTTCTTGAGCGGAACTTGGTTACCCGCCTTGCTGGGTGGAACTATGATACCCACCTCGCCGTGTGG
AACTTGGTTACCCACACCAGGAGCGCTTCCAGCGACGACCGCATCAGTTATGGTCTGAGTGACCTCCTGTGGAACTATGTTACCCACGCCAACGTCAGCG
GCGCCTTCTCCAGCAGCCCTTGCTGCCTGCGGTACTTCGTTACCCGCGTGTGGACCTACGTTACCCACCTAGTAGGTGCTGTCCGGCACCTCCACTCTCA
GGCCTTCTCCGGCCCGGTCGGAGTCGTCGTCAGTCTCGACGGATCCCAAGACCTCATTAGACGCTGCTGCGCCCTGGCGGCCCTAGCGGGCGCCCCAGCA
GCTGCCAGAGGTGGGAACATGACTCACCAAAGCTCTGTCAGAGCGTGGGGGACGGCTGGCCCCGATGACCTTGCCGCGCCAGTCGATCCAAGGCTCGTGT
TTCTCCAGTCACGGCATGCCAAGGAT