Description :
From Genome Similarity Track
Location :
Scaffold_7:112533- 114447
Sequence
1914 bases(100 bases per row)
AAATATGAAGATGTTTTTCCGGATAAGATCTCAGCTGAGTTACCAGCTGACTGAGGATTTCGCCACTAAATCGTTCTCGCGCCCGGCTTGAAGTATTGTG
TGACGCAGCAGTGGCCGCTCCCACAAGATCAGGTCCAAGCTATCGATGACTTCTTGGAGAGCCGCCGCAAGGCGGGTCGCGTGCGTGAGAGCACATCGCC
GCACTTCCGTCAGACATTCTGTGTGAAGAAAGCAACGGGTGGGTGGCGCATCGTCCATGCCTTCAAGAAGCTGAACGACGCTGTCCAGACGCCGATTCTT
CGGAAGGACATGGTGCTCGACGCTATGTCGGGTAGTGAGGTCTACAGCGCCATCGACTTGATCGATGGGCTCTATCAATTCCTCATGAGGCTGAGCGACA
TACAGCTCACAGCGATAAGCACTCCCAGTGGTATGCTCTGGGGGTGGCTTGCTATGTCACAAGGATCGAAGAATGCCCCCGTTCAATCGCATGGTATCCC
ATGTGCTGCGCCCGCTCCGCGATTTCGCACCGAGGTACTTCGACGACATCTTCGTGCACAGTCGCGCTCGAGGTTTACTTGAAACATCTGAGGCAAGTCT
TCCTAGTGATGCGCGAAAACAAGCTGTACGTATACTTAAAAAAGTGCATCTTCTGTGCGCCGGAGATTTCAATGCTTGGCTGCTTTGTGAGCAAGAACGG
CGTGCGCGCCAAACTCGAGAAAGTAATGTCGATATGTGCGTGACCTACGCCCCAGAATCCCACTGAATTGCGTAAGTGGCTCAAACTCGCAAATTATCTT
CACAGGTACACGAATAATTACGCCAGATCGATCCATCCGCTTTCTTCATTGTTGAATAAAGATGTGTCGTAGTCATGGACATCCGCACATCAAGGCGTCT
TCAACTCGGTGAAAAAGAGTCGTGTTGAGGCCCCAATCCTCGCGCTCCCGGATGACTCGAAGCCATTTGACGTCGTCTGCGACGCGAGCGGTTTCGCCAT
CGGCTGTGCGCTGATGCAACTCGATGATGAAGGCCGCGAGCGTGTCGCAAGCTACCAGACCAGACAGATGAAGCCGGTGGAGCGTAACTACCCTGTCCAT
GACAAGGAGCTCCTTGCGGTGCGCTACGCTTTGACCAAGTTGAGATTGTACTTGTTGGGTGAGAATACCTTCGCGGTGTACACCGACCATGCATCGCTGA
GGGCAGCGATGAAGAGCCCTCACCTCTCCCAGCGGATGCCCCACTGGCTTTCATTCTTCTCTGAGTCCAACCTCGTGGCCCATTACAAGACCGGCAAGAA
CAACATTCTCGCCGACGCTTTGTTTCGGCGTCCCGACTACGACCCACGCCGTGCATTGGGTCGGCAAGTTTCGCTCGATGAAGACGATGTAGAGCGTGTG
CCACGTGCGAGGCGTCAAGAGTCAACCTGACGAGCGTCTCCCCTATAATGCCACTTCGCGACGAAATTCTAGATGCGTACGAGCATAAATCGACGTACTC
CAGTATCCTAAAGCATCTTCGCTCTCCCAGCGCCGACACACTTGGAGCTCTTTCTCGCGTGTACGAAACCATATTCACCGATATCGTCGTGAGGATGGGC
CGCTGACGTACAGCATCAACAATTTCGATGCCCCACGTGTCGTTGTCCCTATCGACCCCGATCTGCGCTCACTGATTTTCCATGAGTTTCATGACGCCCC
GCTGGGTGCTGATCTTGGTCGCGAGAAGGCATTTGCCGCTGTGCCACGCGACTTTTATTGGCCCCATCTGTATGAATAGGTACGTAAGTGGGTGCGCACC
TGCGAGATCTTCCAGCACGTGAAATCTGCTTCGTCGTCGCAGGCCCCCCTGCGTCCTCTGTCAGTGGCCACCGAGGCCTGGCGCTCGGTGTCGATGGACT
TCATCTTCGAGCCC