Description :
From Genome Similarity Track
Location :
Scaffold_54:11251- 13039
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15776NADH-ubiquinone oxidoreductase

Sequence
1788 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTCGAGAATTTGAAGCTCTTCCAGCGAAATTTCAA
TCCTTTTTTCGAGTTTTATCGTGAAAAGATCGCCAAATTCTTTATGCGGCGATAAATGTCTTCATTTTGCTTCGACAGCAACAAATAATCAACCAACTAG
CTTGGTGGATAGTTCTCGAGCAGAAGGAGTGCGAGCAAATACATATTAACTGAGGTTTACTTCATCTTCCTACGTCGATGTATCCATTCTTATAAACTCC
AAAAAGCGCCAAAAAAATCCAGAGCTTCTCCACTGCTGGCGCCCGGAGAAGCTTTTGAATTTAGTCGACTAAATTCAGCGATATTTTAGAATTGCTTACG
CTCGTTTAGCTGGTCGCAGATTGATGGCATCGTCATCATGTTGCTGTATCGCACAAATGCCACTTGCCGAATGGAAACCGCAAGCGTCTTTCCTCCGTAC
TAAGTACTGTATGACATATGCACACATTGTGAGCATGCAAACTCCTTCACCCTGGCCACATGCCTAGACCTATATAAACGCTGCGCTGCGCAGCCTGCGC
GTGCAGGCACGCAGATCAAGCTTCGCTTTCATCAGCTCAACCGGTATTTCTCAGCTAACGTATTAGTGCCCATAATCCGAGATTATCGGCGACACGAATC
ATTTGTTAAACCAGCCAATAGCAGCACGTGCGTGGCATCATCCAGCGCAGGATGACCCCACGTTGGGTACCAACGCGACAAGCCCAATGTGCGAACCGTC
ACTTTATCTTCCCCCCAATCTCCGCAAGACCAAACCGAAACGATGTGGGCCCGCCAGCTCGCCACCGTGTCCAAGACTGCACGCAGCACCAGTACAACGT
GGTGGAAGCGTGCATCGTCGACACTGGAGTCCCGTCAGGATGAGACCCAGCAGCCTGCGAACTTCCAGCTCGTCATCGTGGGCACAGGCTGGGCCGGCTA
CCAAATGTTCACGCAATGCCGTAAGCATCTCGTCGACATCGAGGAGACCGTGGGCCGAGCTGTGGACCTCGTCGTCGTCTCCAAGCGTAACGTACGTCCA
CAATCTCACTTTGTCAACTCGTAAAAACTTAAATATCTGACGTTTTTCTATCTGCAGCACTTCCTGTATACGCCGCTACTGGCCAGCACAACAGTGGGCA
CCCTAGAATTCCGCTCCATCATTGAGCCTCTGCGCGACAGTATGTTCAGTCACGAGAGCGACTTCCACTTCGCCAATGTGCAGAACATTGACCCGGAGAA
GAAGCTCTTGAACGTCGAGTCTGCTATCAGTGCTGAGAGTCGTCACCGCAAGTACGACATCAAGTACGACGCCCTGGTGTTGGCTTGTGGCTCTCGTCCG
CTGACTTTCGGTCTCCCTGGAGTGGAGGAGCACGCCTTCTTCTTGAAGGAGATCCACCATGCACAAAGGATCCGTAACCGCATTCTAG