Description :
From Genome Similarity Track
Location :
Scaffold_1578:1125- 4074
Sequence
2949 bases(100 bases per row)
ACGTCACTCTTGTGCATAAACATTCACTCCTTCCTCCTAATCCACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATTAG
CGATCCTCCTCCTCCTGGCCCACACCCTTCCTGTGGGTCCTTTTTCATCCTCCCATCGATATGACCGACTCACATCAAGGGATCCCCTCCCTACTCTTCT
TCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGATTAATGCTCCGCAGTTCAGATCTGCCTCGTCTACCCAAC
TCGGTTCGTCATATCCGCGCCAATACACTAGAAATTCACGGTAAATCCGTCCGTATCTTGTTCGTTTCCCTGACCTCATATCGGTGATCCTCTCGACTGT
GTAACTAATTCCGTCGTCTTGCAAAACTCACATTCCCAACTATCTTTCCGGTAGGAGGAAACTTCCTCCAAAATCTCAGCGCGTGCGGAGAAATTCCACT
GAAAGACGGATCTGTGGCCGATCCGGATATTCTTTGACCAACTCAGCTTGGATACGTGTACTCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCA
GCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACTCGATCCAAATA
AAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGACCCTGTATCGCACTCCGCAGTCGTTCGTTCACC
TGGGATCTAGCTTGCCGGTAGTACTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTCCTCTTCTTGGTGCTGCAAACTGGGATTGCCGCTTCCA
GGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTA
CTCATCCCAATCCCTCTGATCAAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGA
TATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGC
TAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGCTTGCGCAGTTCTAGACGCACTAGCTTTGACTATCACGTATCCGGTAAACAA
ATCCACCCAAATCAACATTTCTGTGTTTCCTTTGAACGACTTGGCCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATA
TTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTCC
AGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGT
TTTCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTAACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTAATACAGATCCACTGCGTAATCC
GTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTACATCTACCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTT
GTGCTTTGAGGATCCGCTCAATACGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCAT
CACCTGGACTGTTCTTTTCCTGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGATCCTGATGCCCGGCTTCTCTCTCCACTTCGACA
CCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCATCCACGCAGGT
GGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCAC
CAGCCTTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGACCTTCTGCGTAAGTGGATCTG
GCTCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACA
GATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCG
AGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAGAGCTGCCCACTGT
CCCAAACGTCCTTGTCTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACAAGCAGGTTGTAATTCAGATCCAACACG
CGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGCTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCAT
GGCTTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGC
GATCCTGTTCCTCAGTTCCACGAATGCGTGTTGATCTCGGATCCACCGA