Description :
From Genome Similarity Track
Location :
Scaffold_131:1125- 2948
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_131-snap-gene-0.18Myosin
Pytul_var.sporangiiferummaker-pug3_contig_131-fgenesh-gene-0.6Myosin

Sequence
1823 bases(100 bases per row)
AATCCACTGCTGGAATCGTTTGGAAATGCGAAAACCATCCGTAATGACAACAGTAGTCGTTTCGGCAAGTTCATCAAGATCTACTACAAGGACGACGGCA
CGATCTCCGGCGCCACGACGAGCCACTTTCTTCTCGAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGTGCGCGGGCATGTCGGCCGAGGAGAAGCAAGCGCTGAAGCTGAAGAATGCGGTCGATTACTACTACCTGAACCAAGGCAACTGCATCCAG
GTCCCGGAGATCAACGACAAGAAGGACTACAAAGAGCTTGTCGAGGCGATGGGCATTGTCGGCATCGCGCCCGATATCCAGAAAACGATTTTCACGCTCG
TCGCGTGTGTGTTGCACCTCGGAAACTTGGAGTTTGAGGAGAACGCAAAGCTCGAGTCGGTGATCGCGAAACCGCAAGAAGTGATCGATCTGGCGGAGCT
TCTCATGGTCACGCCGGCCGAGCTCGAGTTTGCGCTCACGAAGAGAACGATGTCGGCTGGTGCTCGTGGATCGGTGGCGGAAATCTCGCTGTNNNNNNNN
NNCGAGAAATGCGCTGAGCTTCTTGGCGTCACGACCACAGACCTGGAGTCGCTCTTGCTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATCCAACAAGTCGCGCAACGGTCTCGCAAAGGACATTTTCAGTAAAATCTTCGACTGGCTCGTGTCGCAA
ATCAACCTGTCGACGAAGCAGATCTCACAGGGCGAAGGCGGCGGGATGGGCGCGTCCAAGTTCATCGGCATCCTCGATATCTTCGGCTTCGAGAGCCTCG
ACCGCAACGGCTTTGAGCAGCTGTGCATCAACTATGCGAACGAGCGACTGCAGGCGCAGTTCAACGAGTTCGTGTTCATCAAGGAGCAGGACGTGTACGT
GTCCGAGGGCATCGACTGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTGTCTCTCGCTGTTTGACGACAAGGCG
AGTGGACTGTTCTCGTTGCTGGACCAGGAGTGTCTGATGCCGAAGGGGTCGGACGACGCGCTCAGCACCAAGTTCTACCGGTACCATGGCGGCAACGAGA
GTGCTGTTTCCGGTACAGCTCTGCTGAAAAACCAGCAGAGTGTGCCAACGTACTCGCTACCGAACCTCGTGACCTCGTTCGGGAGATACTTACACCAGCC
GTCGGCGGCGGCATCATCGGACCCCATTGAGCGCGAGCCTGAGCCAGAAGCAAAGGCGCGAAAGCCGTTCTACGCGTCCAAGATGGACCGCGTCAAGCAC
CAGTTCGTCGTGCACCACTTTGCGGGCAAGGTGTCGTATAAACTCGAACAGTTTGTGGAGAAGAACCTGGACATGCTGCCTACGGACGCGACGACCGTGT
TCAATGCCTCGTCTAACGCGATCATGAGCGCGATTGGCGACGTGGACGTGATTGAACAAGTCGCGGAGCGAGCACCTGGACGCCGACGAGGCTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTCTGCGCAGTTCAAGAGCCAACTGGATCGCCTCGTGGAAGAGATCGGGTCCACGGAAGCCCACTA
TGTGCGCTGCTTGAAGCCGAACGAGGTCAAGCGCCCTGGTATCTTCGATCGCGAGCGAATGGTAGAGCAGTTGCGGTCGGTCGGTGTCCTCGAGGCGCTA
CGGATCGCGCGTGCCGGGTACTC