Description :
From Genome Similarity Track
Location :
Scaffold_3177:1125- 2621
Sequence
1496 bases(100 bases per row)
GTACCGAATATCGCTTGTACCCCGTGGTACATGTATCCAAGCTGAAGCTGGTCAAGGAATATCTGGACCGACCGCAAATCCGTCTTTCGGTGGATGAGCC
CGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGGGAAGATCGCCAACATGAGG
TCAGGGATGCGAACTAGATTTGGACGAATTTACAGCGAATTTCTGGTGTATTGGCGTGATATGTCGAGCTCAGTTGGGAAGACGTGGCAGATCTGAGCTG
TGGAGCATTACGCTATGATTTCTTGCGGGACCGTACGAATCGGAAGAGATTCGGCGTGATGCAGTCTTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGA
TTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCTCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCG
TCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGGCTTGGCGAGACGTGGGGATGGGCTGGAGCAGCAGT
GGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCGGGGCCTACATTTGGGATCTGGCCGTAGGGCTGC
CTTGCGGGTGTGTTTCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCTTCCTGTGACGGGATCTTGAGAGTTGAGACCTTCTAGGGTGTAACCGA
CCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGTGTATAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATATATTATCCAGTTATCACTACC
AATACTAGATTCGCAATTCCCAACCTTCCCCGAGCTCGTACGGCCAATGTAGTTCCGGTACTTGAGGGCAGGAAGGCACTTGCGTGATACTATGCAAATT
GAAGTCTGTATTGATACTTAAGACTATATCTGCCTGGATTTCGACCTTCTATGTCTTTCACTTGTTAAATTCCTTACCTGGCTCGGCTGCATGTCCCTTC
TTCCTTGACCCATCATCCCAGCTGGATTATCTTCAGATCCACCGGATCCATGGCGTAATCCTTATGGTCACCCTATTATGGGTACACTCATCCGGATCCA
GGTCGCTTGGATCCACTTCACTGTAAGTGTACACTCGTCGTGGATCTGAGCTCTCCAATCATCCCAACATCATCTCGCAGCCGTATGTGATTTCCATTGT
CCCCACGAAAGGTGCGAGGGCCACCGCATCCCATCATCCCCTGTACCCTGGGATCCAGGTCCCTCCATGCGGGATCCCTCCCTCCTTGGATCCGAAACTC
CGAAGTATGGGGATCCCGGGAACACCTCCGCGGGGGATCCGGACCTTTTGGTAAGCCGTGGGTTACTAGGATCCCCCTTCCAGAGGGCGACCTACC