Description :
From Genome Similarity Track
Location :
Scaffold_155:112492- 113765
Sequence
1273 bases(100 bases per row)
AGTCGGCCTCGCGTCAGCGAACACCGCAGATCTGGCGATGTGGTGCCCGATCTCCTCCCTGGGGAGTCCAAAGGGTACTGGAAACATCATTCGCCAGGTA
AGTGGTTCCGCCAGGCCAAGATCACTGGCAAGATCAACAATGAGAAGTCGATCTTACTCTTAGACACCGGCGCCGAGGTGTCCATCGTGGACACCGCCTT
TGCTCGTAAGGTGGGGTGCTATGTCGACACGAGTCAGAGCCAGGAATGTGTGGGGATTGGCGAAAGCGTGTACATGACAGAAGGAAGGACCAGGATCAAG
GTTACGCTGGCGGGATCGCTGGTGTATTTCTTCGATATCTGGGTTGGCGATCCATCAGGACAAGAGGCGATCCTGGGTATGGAATTCATGGTTCCGGCGG
GGATCCGCCTCGATCTTGCGGACGGCTCTATCTGTCTCCCCGACGAAGCCAAGATCCAGCTAAGCGGACGGCGTCAGCTGTACANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN