Description :
From Genome Similarity Track
Location :
scaffold_41:11248- 15941
Transcript NameFunction/comments
g1810.t1 hypothetical protein PHYSODRAFT_321724

Sequence
4693 bases(100 bases per row)
TGTGGCTCACCCGTTCACAGAATATGCTACGACTATTGTCATCTAACTCTTGCGGCTAGCAGACTTGGACGGTGGGGCCAGGGACATCATATCGTACCGA
TCGTCGACCATACTGTGCAAGAGCACATATCGCTCTCTCCCAACGCCACGCGAGTTGGGCTCAGGAGTCAACGACAGAACTTCCTCCATCGTGTACTTGA
GCTGCTTCCGATATCGAGGATTGTTGGCACATACCGTGTCAATGCCACCACGTCCTCCTTCCATCAGCGCCGACGACATTTCACGCACCAAAGCGAACGG
GAGATCTACCGACAAGACCTTCATGGCCTCATCCCCACGTGATGAAAAGCTGGACGAGATCCACTTGGATACACGACGCTGAACCTTCTGCGTATCGAGC
TGGTAGTTGCGGTAGTTCCTGTCCCTTGACTGGTACTTGGCGTCGACCACTCGAACGTCGAAGATTGGCTGCAGCGTATTGTTATTCGACAAAGAACTGC
CGCCTCCACCGCTGTTGTTGCTGTTCATACCGTCCCCAAAGTAGTTATTTCCTCGACCACCACCCGTTGTCGTGTCTCCATGTGAGCTTTTGCCAACATT
TGCCATCAATTCGCTGATATATTCTGGCAAAGACACCACATTCGTCACCACATCAGCCTCGGAATGGCTCTTCACTGCTCGGATCTTCACTTGCTGCTTC
TCTCGTAACATGTGCTTCTGTACAATCACCATCCAGTGCACATTCTGCTGGGCGCAGTAGTCCTCGAGGTCTTCCAGATGTAATGGCTCCGGGTGCAGGT
ACTCCGCACCGATGCCCTGTCCCCACAAGAGCAACGCGATCTGCATGCGAAACAGCATCGTGTCGGACGCTTTACCGGCCGAGCAGATCAAGACCTTCCG
GCCGCCAGTGAGAACTTCGGAGACTGGCGATTTGAACTCCAACAGTGCGGGGCTCAAGGATTCAGCCAGTAGCGAGACGATCTTGTCGATGGCAAAGCGC
ACGCCCATGGCAGCTACTGCCGAGGCTTTCGCGTAAGCGGTAGTGAGTTTGAAACGCGACACCAGCGCATCGTACCGTCCGCCCTCTGCGATAATAATCT
GGTTATCCGTTGCTGCCACCAGCAACGATGCAGATTTGTCGCCATTGTTCCCTGCATACGTGGACTCTTCAAGCAAAATGGCCTGGAAGATGAAGCCTGA
CGTGTATCGCTCTGGCCGTGGACTCAAGCCTAAATCTAACCGTGTACACACCGGACCTGATAGCTGGAGGAACTGCATTCCCTGTAACAATAGACGCAGA
GACGTGATGCCCTCATTCACGTCCTTCACGATGCGTCGTAGCTGTGCATCACGCTTCTGAATCTGCTTTCGGTCGGCTGAGGATGAAGATCCAGAGCCAT
TTTCTCCGTCCGACCCCACCGCTGAGCCTCGGTTCGTAAGCGCCCGATTCTTTGCAAAGAGCTTCTGCACTTCCAACTCAATCATGTCAAGTGATGTCAG
GCAGTCCTCCGGCAAGAGGAAAAAGGGCTTTAGAGCGTCGATAGCGCTGGCTGGAGCGCCGTAGTGCTTCAATCGTTTCGCGACAAATTTCCAACGACCA
GGTTTTAAACTAGGCGCCTGAGTAGATGATGGACCAGCGTGGACGTAGAACGAAACCTCGTTCGAAAGCAGTCGCAGAACCTCTCGACGGGCGCTGCTGG
GGACACGGCACAAATCGAGAATGCCGCGCGTCATTCGGGCGTCGTTGAACCGCAGATAGTAGGATCCCAGGCAGCTTGGCAACGCCTTGATCACGCCCGA
CACCACTTGCAGCCCCTCTAGCTCCAAGAAACGGAATGAACCCCCGTCGTCCCAAATGATGTCGAAGTCAGACTCAGTGAACTCTCGTGGGTGGCCGCCA
CCGACGCTTTTCCGATACACACGGTCAAATTGGAAGCACTTGAGCCGTGAAACGTTGTGCCGCGCCACAAAGCGAGCAAGCCTTTCCGTCAGATCAAATG
GCAAAGACACTGACACACCGTTGCCATCCAGCATCATCGATGCGTTCGGAGGAGCGCTAAGCGCGATGCCGTTGAAGTTCTGCTCCGATAGACGTGGCAT
GAGTAACGGCGTCGACATTTCAACTGCTCCGTGGCGCTCGAACACTTTCTGCAATACGTTCCTGACGTAGGTTTTCGTGCGCAATTGAACCTCGTAACTG
CGCATTTTGACCGACTCCAAGTGATCGTAGGTGTAGTCGACGTGGTTGAGAGGTTCCTGCGAGACAAGCGCGTCAATTAGCTGTCCGAAGAACTTTCCCT
GCGGGTTTGCGAGAGTATCCAGCGCCTCACGAAGATAAGATCCTTCCACCTCGATCTTTGGAGGCAGCAGGGGGCTTGCCAACAGCTCTTTTGCGTTCGG
CCGCTTGGACGGATCACGTTCGCAGAGCCACAAAACGATCTTCTTGACGTCGTCAGAGGCGCTGAATGCTGCTGGAAGTTCGTGTCTTTCTCTCAAACCG
GTCAGCGCCTGGGCACGCTCCATCAGCGTTGTGAATGGTGGCGACCACATCTCGAAGAACATAATTCCAAGCGAGAACAAGTCTGCTTTCTGGTTGTATC
GCTGGCCTTCCCGTTCCTGCTCAGGTGCTCGGTAGAACGCTGTGCCGACTCCAGCGGTGATATTCCCGTCCCCCACATCCGCTGACATTGTGGTCATGAG
ATTGCTGTTCTGTACACTCGATCGGCCGACAACTCGAGTGCTCTCCAAGTTTTCCAGTTTCAGCCGCCCGTACAATTCGGCCGCTGAAGAACCAGTTGAC
TCGGACAAAATCGCGCCAGTCGCCGTTTCTCCAGGAGGACTGGAGTCGTCATTGCTGCTGTCATCATCCAAGACCTTGGCAGGCCGAACAGCGAGACCGA
AGTCGCCCAGTTTTACAGTCCCTTCAGAGTCGAGAAATACGTTGGGTGGCTTGATATCACGGTGGATAATTCCCTGGCGGTGGATATACACCAACGCCTC
TAGAATCTGGCGGAACATTGTCCAGATCTTGTCGGGATCTTTCCACAGTGCTCCCTTGTCAATCACCTCCCTTAAAGCATTTCCCTCGCAATACTCCATC
TGAATATACAACTTCTCAAACTTCCTCTTTCTCTCGGGCACCGGTTTTCGGTGAGGCAGCACCTTCTGTCCATACACATCACCTTCATCGTCACTGGAAT
CGTCCGCCTCTTCCATTGGAGCTTCTTCCAATGCCTCCCAGTCGAACCCATCCTCTGGATAGCTCTCGGACGCAAAATTGTGTGAAGAGAGCTGGAACGA
GTGGCTATTGCTACGAAGGCTGCGAGGTTCGTGGCGAGAAGTCGACCAGAGCCCTGTACTGCTACCCATGGCGCCTAGCCAGTCATCTTCATCTTCATCT
GTAGACGTCACGGCTCCCAAACCATCGTCAACTCCAGACGAAAGACTCGCGTCGCCATATATATCTTCTTTCCCACTCACCACCGCCCCACTCAGCTCAT
TTTCTTCATCACTGAAGTCGCTTTCCTCCAAACTGGAATCCTCTTCGTCGTCACTTGACATGCCACTTTCGCCTTCAATCCAGGCCTGGAAGTATCGCAC
AATGTGCCGGTGCTGCATTCGCGAGATCGTCTTCACTTCGCGCAGAATCTTCTTTTTCATCGTTTTATCGTCCGGGTCCAGCTTAACCTTCTTCACGGCA
TAAAGCTGTCGATCCAGACGATTCCTCACCTTCACGACTTCTCCTCCTCCTCCACGTCCCAACAGTCCCAGCTCCTTGAAATCTCCGTGATACCTCGAAT
GGTACCGTTCAGCAGCTGCAACCACATCCAAATCCGACGTGTCTGAGTCCGAATCCGACGGACTTAACACACTTCCGTCTTTCTTGGAGCTCGCCTCCGT
TTGCTGTTCGTAAATACTGGACAGACTCTCACCTTCACTCCCACTCCCGGTATACTCTCCATCAATACTGGCGCGATGTCTCCTTCGTCTCCGTCTTGTC
TTCTTTATCGTTTCTCTCTTTTTTCTCTCAGCGTCAATGAGCGCCAGGATCTCCTCGTCCTGGACCCTTGCCTTCTCCTCCTGTTGCTGCATCAGCGCGT
CCTCCTCCATCTTCTCCTTGGTCTCTATATCCTGCTGACGAGTCATCATCTGGTCGAAGAAGGACGACTGGTCTTTCAGATGGTCCTGGATAAAATCCGT
GGCGAACACCACGAGGTCGTAAGTCGAGGCGTCTCCGACCTTTTCGAGCGCGAGCATCTCCATTCCACGCTGCAGCTTCTGCGTCTCCGTGTCTGACAGT
CCGTGCTTGGCTTCCACTGTAATATTGGGCGGCTGCTTGAGCGGATAAGCTCGGGAGAAGTCGAAATGCAGAAGAACCTCAGCCGTGGTGGCTGAGCCAG
GAGTGGCTTCACACACCAGCCGAATGGCGAAGATGTAGCTGTACATAGGCGTAGAGCTCTGCGCCACGAGGTCGCGGTCGAATATAGCCTGTAGCACTTC
CAGTTCCTGGGCCTGTAGCTCCCGTGCTTCGGCTAATGTGGCGGCATCATAGGTGGTTGGGGGATCGGGTGCCGCATGGGCGTCTGTAGGCGGAAAATAC
GAAGATTTTGAGCGGAATCTTACGTAGTTAGATAGAGGAGACGTATAGCTAGTACGTTACCTTTCTTCTTGCCCTTCTTGCGGCCCATGGACG