Description :
From Genome Similarity Track
Location :
Scaffold_23:112434- 114596
Transcript NameFunction/comments
Physo_344600Eukaryotic/viral aspartic protease, active site

Sequence
2162 bases(100 bases per row)
ATGACCTGTTCGACTTGGACATCGAAGTGCCAACAACCGCGGCCGCCGTCGCGACGGCGACAGCCGGCGGCGTAGCCCTCGCCCGCGTACGCCTCTCAGC
ATCTTCCGAGCTGAAAGAATTCTTAGGACGGGACGCCAGCGAAGAGAAAGCCAGACTGTGGCTCAACCGTCTGAAGTCCGCCGCGCGGCGCGACGGGATG
ACGGGCGAAGAAGTGTGCGGGCAGTTCAGCGATCTAATGAGCGGCCCTGCGCGCCAATGGTATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCG
AGCTGATGGAGCAATTCCGGGTGCAGTACTGCGGCAAGGGCGTGTCAATGGCCAGTCGCTACTACCATGCGGCTCAGCGCCCCGACGAGACCCCTCTGGA
TTACTCGTACCGGCTCAACGTCGCGGGCATGAGGGCCAACATCCCATACGCCGAGGGCACGACTGAAGAGAAGCGCGAACACGACGAGCATTTCATCCGG
ACGCTGAACACGCAGGAGGCCGAACTCGCCTCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAGCTGCGTGCCCAACAACGTG
GATTGGTTCACCAGAAAAAGACTCTCTTCGGCTCGAACAAGTTCCGCCAAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCA
CGTCGCGCCGGACGAGTACGACTCGGAACGCGAAAGTCGCGACAGCGACGATCGCCAGTACGACCAAGGCGAGGCGGACGAAGAACGCGCCAAGTTGTTC
GTCGCGGGACAGGCCCCGCCGGGAGAGCCGGCGCGTCGCAACTTCGATCCCGACGACTCGGGACGCGACCGCCCGTGGTGGTTCACGTCGCCATGTCGAA
GGAGACTGCTGGAAGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACAAAG
TCGGAGAATGCCCGATGGAGGAGTTCTTCAACCAATTGCGCCAGTGGTTTGACCCGAATAAACACGCGGGAATGCTGCCGCCGGCCGCCGAGAAGATGTT
AAACTAGGCGCTCGCTGGCTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGCAGTCGCGAGAGGTGGTTAGTGAGAG
CCCGACTTCCCTGAATGATAATACGTGTGAATCCAACCCGGAACGTACCACGCAAGAACGCGCGCTGCGAATCTCGGCGGTCCGACGTACGACGGACGAC
GAGTTTGCACGTGAACCACCCCTGGATGAGATCGACTTGCAACCAGGAGAGCGACGCGGATACTGGAAACATCACGCGCCGCACAAGTGGTACAAGCAGG
CCAAGATTCATGGAAAGCTGAACAACTGTCGTGCTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCATCCTGGACACCACCTTTGCTCGTGAGGTAGG
CTGCCTGATTGACACGGAGATCACGCAAGAGTGTGCGGGAATTCGTGATGAGACATATTACACGGTGGGGATAACCAGAGTCAAGATTACCTTGGCTGGG
AACTTGGTGTACTACATGCACCTGTGGGTCGGCGACTTGGTCGGCCAACACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAGTGCGCATCGACA
CTGCGGATGGCACGGCGTGCCTCCCCGACGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACGGCGCATGGATGCACCCGGTCAACGTCAAGAC
GCCTGTGAGGCTCGAACCAGGAGACACGCATGAAGTCTTGCTGAGGCCAGATCGAAACGCGCCGTTCCTGTGGGTGACACGGGCAGAGTCGTGGCTGACT
ACCTTTGTCAAGGGGAGAGTCGGAAAGAAAACGTACCTGCGTGTCACGAACATCGGAGACGCAGCGATAACCCTCGACGCGCATGAAACGCTTGGGTGGT
GGACGCCGTCTGACGGCCAGCCTCTGGATTCGTCCGACTGGGCTCCACCCGGTACCAGCAGTGGCAGAATCTGGCGTACGGCGCGACGCGCGACGCGGAG
GAGAACTGGATCCCAGCCGAGCTCGACGGACCGATGACGGATCGCCCCTCATACCCGACGCC