Description :
From Genome Similarity Track
Location :
Scaffold_353:11241- 13446
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_353-fgenesh-gene-0.4Molecular chaperones HSP70/HSC70, HSP70 superfamily
Pytul_var.sporangiiferummaker-pug3_contig_353-snap-gene-0.12Gene of unknown function

Sequence
2205 bases(100 bases per row)
GTTTAAAAGCGGATCATACGCTCCAACGAACGCTTCTTGTCTTCCAACTCGCGGAGGGTAGCCTCCTCGTGCTCCTCCAGCCAGTCGCGGGNNNNNNNNN
NNNNNNNNNNNNNNNNATCGACGTCTCGACGTTGCTGTCGCCCTTCTCGCGCGCAATGTCGATGGCGCGGTAGATGAACTGTTCCAAGTCGTTGCGCGCT
TCAATGCGACGGAGCAACTCAGCGTCGTCCTTCTTGAACTTCTCGGCCTCGGCGACCATGCGGTCAATGTCGTCCTGGCTCAGACGGCCGGCGTTCTGCG
AGATCGTGGTCTCAGCACGGGCGCCAGTCTTCTTGTCGCGAGCCGACACGTTCAAGATACCGTTGGCATCGATCTCAAAGGTCACTTCGACCTGTGGCTC
ACCGCGCTTGGCACGCTCAAGACCCGAGATGTTGAACTCGCCCAACTTGTTGTTGACGGCGGTCGACGCACGCTCACCTTCGTAGATGCACACGTCGACG
GNNNNNNNNNNGTTTGGTAGTCCTCTTCAGTCGTGTACACACGGGTCTTGCGCACTGGGATGGCAGTGTTACGCTTAATGAGCACCGACATGACCTTGCC
GACGGTCTCAATACNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCGACAGTGGGGTCACATCCACAAGCAAGAGCGAGTTGGTCGCGTCGTTGCGGATGC
CCGACAAGATAGCACCCTGCACGGCGGCACCGTACGCCACGGCCTCATCAGGGTTGATCGACTTCGAGAGCTCCTTGCCGTTGAACAGGTTCGACAACAT
GGTCTGCACCTTAGGGATACGCGTGGAACCACCAACAAGCACCAACTCGGTGATATCCTCCGGCTTCATGTTGGCGTCGGCCAACACCTTGAGCACGGTC
TCCTCACAACGCTTGAAGAGCTCCTCGCCAAGCGATTCGAACTTGGCACGGGTCACAGTGGCGCTAAAGTCCACGCCCTCAAAGAGCGAGTCCACTTCGA
CCGAGGCCGACGTCGTGGTCGACAGCATGCGCTTGGCAGACTCACAAGCCGTGCGCAGACGACGCATGGCACGCGCCGACGTCGATGGGTCCAAGTTGCG
GTTCTTGCGCTTGAACTCGGTCAAGAGGTACTCAACCATGTTGTTGTCGAAGTCCTCACCACCCAAGTGGGTGTCACCGCCCGTCGACTTGACCTCGAAG
ATGCCGTTCTCGATCGACAAGATCGACACATCGAAGGTANNNNNNNNNNGTTCGTAGCCAACACTTCGAACACACCACCATCAATGGCAAGCAGCGTCAC
ATCGAAGGTACCGCCGCCGAGATCAAACACGAGCACGTTCTTCTCGCCCTGGGCCTTCTTGTCAATACCGTAGGCGATAGCGGCAGCCGTAGGCTCNNNN
NNNNNNACGATCTGCGGCTTGTTGTCGGCGCCCGCGACGACCTTGAATGGCCAGTGCTTGATGTCCGCTTGAACGACCGGGTCGGTGAACTTGCGGCCNN
NNNNNNNNACGTTCAAACCGGCAATGGCACCGGCATCCTTCGTAGCCTGACGCTGCGAGTCGTTGAAGTAAGCTGGCACGGTAATGACAGCGTTGCGCAC
TTCCTTGCCAATGAAGGCCTCCGACACTTCACGCATCTTGATAAGCACCATCGACGAAATTTCTTCTGGCTGGAACGTCTTCGATTCACCCTTGAACTGC
ACGGTGATCTGCGGCTTGTCGCCTGGGCCAGCCGACACGGTGAACGGCCAGTGCTTGCAGTCAGCCTGCACGATTGGGTCCGAGAACTTGCGACCGATCA
AACGCTTAGCGTCGAACACCGTGTTGTGCGCGTTCATCGCGACCTGGTTCCTCGCCGCATCGCCGATCAGACGCTCCGTGTCTGTGAACGCAACGTACGA
CGGCGTCGTGCGGTTGCCCTGGTCGTTCGCGATGATCTCAACGCGGTCGTGTTGCCACACGCCGACACACGAGTACGTCGTGCCGAGATNNNNNNNNNNG
ATCAAACGCTTGACATCAAACAACGTCTTCTCTGGGTTGATTGTCGCTTGGTTCTTGGCACCATCACCGATCAGACGCTCGTCGTTCGAGTCCCAGGCGA
CGTACGATGGCGTGATACGGTTACCTTGGTCGTTCGCAATGATCTCCACCTTCTGGTCCTTGTAGATGCCGACGCACGAGTACGTCGTACCGAGATCGAT
ACCGA