Description :
From Genome Similarity Track
Location :
contig_27:112401- 113980
Transcript NameFunction/comments
g5911.t1hypothetical protein

Sequence
1579 bases(100 bases per row)
CATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACCATCCCCCCGTTAGGATTTGACGTGCCGGTCTCGACACGTCAATCCGTATT
TTCTTCGGGAGAACACGTGCTCATTCCCAATGAGCACGCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTC
CAAGGCGACGACGGCCGCTGCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCT
GGATACCACTCGAGATGGCATGAGAAACATGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGCATCTACTCTCCGGGTGGAG
AGGGAGTTCCCCTCGACTACGGAAGTGAAGTCGAGGAGGGGGAACTCGAAGGAGACAAGGACATGTCTCCGGGCCACACTGACCCAATGTGGGTCTGCGT
CGTCCACGCGAGGACGACCCGAACGCTTCGAGCTCGAAGCGTTCGCGCAGCGGCAGTGGAACACCGCTCGCTGCCGCTGGAGCCTTGACGACTCCGCGGG
ATGGAGATGACTCCACTCCATCCGCTGTTGCGGCCTCGCGCACTGAACCAGTGCGCGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGG
TGCGACCGCGCCACCGAATCTGTACGCGCTGTATCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGAGTACACTTTGATCCGTTAACGAATCAAA
GGCGCGACTACTACATCGGGCTCTTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCA
AAGTTGGAGTGCCTTTGTTGAAAACTTCAACAAGAACCCCGCTGGCTATCGCGACCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAATTCTCGAAGCGT
GGTAAACTTGAACGACTGCACCATGGTGCAGTCGGTATTGGACTTCCTTGCGCAGTGCCTTATGACACTGCTTGTGAGTACTGCTACCCCGGAGCAGTAC
GCATCACCGAGCGGGACGTCAACGGGTACACGTCCATGTGTGTACCTGACGACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAGGCGTCTTCTAGTGC
TGCGGATAATCGCAGCACTTATCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACG
CCGTCACCATTTCCGGAATGTCCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCCG
GACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGCGGGAAGACGCCC
CGGGTTTGGTCAACCAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGT