Description :
From Genome Similarity Track
Location :
Scaffold_3614:1124- 2293
Sequence
1169 bases(100 bases per row)
AGTCAGGCATCGTAGCTGGCGTGTTTGACGCAGAGGGCATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAA
GTCCATCACCGGAGAGAGGTCGCGCACTATGGATCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCGGCGGAAGATGGC
TCCGACACGTCGTCCGTGTTGTCAAGAAGGCGTCTCGTCCAGCTTCGGCATACCAGTAAAACCGGTTTCCAAGGACCCCGCGATGTTTACGGTAAGTCAA
TTGCGCAAACGGATGTATGCGCAAACAGATGATTGGACGAGCAGGATGATTGGACGAGTCCAGAGTGTTGGTGATTGGATGCACCACATGATTGGATGCA
GACTAGGACGTAAGACAGAGTAAGCTCCAATAAATCAATCACTTTGCATTTTATCATCTAGTGCACAAACGACCTTCCTTTTTCCCACACACTGGCAAGC
ACTCAAGCGCGTCTTTCGCTACATTCAAGTTACGAAGACGCACGGCATCGAGTTTCAAGAAACAAGTGAAGAAGGACTCTAAGGCTACTCGGATGCGGAT
TGGGCTGGTGACGTCGAGACTCGACGCAGTACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGTTGGAGAAGCAAGAAGCAGCGCACGGTGG
CGCTGTCATCGACGGAGGCGGAGTACATGGCGTTAGCGGAAGCTGCTCAAGAAGCGATCTGGCTCAAGGCATTCCTGTGTGAACTCGGCGAAATGAAGAA
CGAGGATTCTGTCATGATTTTTGAGGACAATCGAGGGTCGATTGCGCTGGCTAAGAACCCCGAGTTTCACAAGCGCACCAAGCACATCGACATTCGCTAC
CACTTCGTGCGCGAGAAGGTTAAAGATGGCCAAGTGGTGTTGCAGTACTGCTCGACGAAGGACATGAAGGCGGGTCTAATGACCAAGCCGATCACCGCGG
TGCAGTTCGAATATCTTCGCAGCAAGCTGGGTATCAAGCCACCAAGCGCGGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGTCTCGTCCAGCTTCGGC
ATACCAGTAAAACCGGTTTCCAAGGACCCCGCGATGTTTACGGTAAGTCAATTGCGCAAACGGATGTAT