Description :
From Genome Similarity Track
Location :
Scaffold_70:112399- 119367
Transcript NameFunction/comments
Phyci_10214phospholipase D PiTMPLD putative
Phyci_82443PREDICTED: tubulin-specific chaperone D-like

Sequence
6968 bases(100 bases per row)
TGCTGCTGGGCGTGTGCTGCTCGCTGGCCTGGCTGGCGCTGCTGGCGCTGGGGCTGCGCCTGGACGCCGCCTCCAGCCTGTACGCAGGCGTGCTCAACTC
GCTGCTGGGCAGCTTCCTGTCGGCCAGCGGCTACTGCTGCCAGAAGTACGCGCACATCCGCGTGGCGCGCAACTCGGCGCTGGGCACGGCCTCCATGCAG
AGCTCCTTCCTGGCCGGGCTCGTGCTGCTGGCCGTGGGCACCGTGTCCGCCGTCATCAACCTGGGCATCCTCGGCCAGGCCGTGCAGGCGCCCTTCGCGG
CGCTCACGCTCATCTACAGCGCGCTGCTCGGCCGCTTCGTGCTGCGCGAGAGCTTCGGCCTCTACGACCTGCTCTCCAGCGCGCTCATCGTGCTGGGCGT
GGGCGTCGACGTGTACGCCGCGCAGCTGGCCGACGTGCCGCACGAGGCCTACACGCTGCAGTCGCTCGGCCGCCTGCTGGCGCGCGACTCAGTCTTCCCG
CTGGCCTACACGGTGCTGGCGCTCACGTACGCCACGCTGCTGCTGCGCCGCGTGCACACGGACAAGCTGCAGCGCCACCCGGTGGGCCTGCTCGCCTTCA
GCTCGTGCGCCGGCGTCATGGCCGGCTTCACGTCGCTCGCGACCAAGTCCGCCGTGGAGGTGGCCAAGTCGGCGCTCGCCCGCCAGGACTGGCTCGTGTT
CGTGAACCCCTTCTTCCTGCTGCTGGTGCTCGCCATCCCCTGCGCGCTCGTGCCGCAGCTCTTCTTCCTGAACAAGGGGCTCGAGTTCTTCGGGACGCTC
AAGTTCATCCCGCTGTACCAGGCGTTCATTATCATCGGCAACATGGGCTGCGGGATGATCTTCTACAACGAGATGGCCAGCTACAGCTCCAACGCGCTCG
TGTACTTCCTGGGCGGCATCATGATCACCATCTGCGGCGTCTGCGTCCTGCTGGTCAAGGTCGATGCCGACGGGAATGGAGACGGCCGACGGTCAACTGC
AGTGAAGGCAGTCGACCGCCCCATGGACGAGCTGCTGGACCAGAAGAGCAAGGACAAGGAACGGTTCGAGACGGATTTCACGTTTCAGCAAATGAAGTGG
GCGACGGAAGGAGATAGCCCCAAGAAAAACGAGCTGCGTGCATTCCGCGACTTCCGTGAGTGCCAGGAGGCGATCGTTGACCTGCTGGTATCCGCTCGCA
AGTCGATTTACTACTCGACCTTCTTGTGTGACTTCACCCAGGTCCTCCACACTACAAATGAGGAGCACAAGGACAGCACGTTCGTGTCACTACTCCGTGA
CGCTGTGGATCGTGGCGTCGACGTGCACATTCTGTACAACCCCGTGCGGGACTACGGAACGAACTCCATCGCCGACCTACGCCTCATCTTGCCGCCAGAG
GTGCACTTCGCCTGCTCTGTCAGCGACCTTGGCCCGAGCTGGTTTACGCGCCACATGTCGAACAACTCGAGGTACGCCTTCCACCACCAGAAGTATCTGT
GTATCGACGAAGAGACCATCATGGTCACAGGCTGTGACGTTAACACGGAGCGTGAGGGCTGGCTCCGTAAGAATCATCTCGGGTACTATTGGCACGAGCT
CAGTGTTATCTGCCGCTGCACGTCTGATATGGTGAGATGGATTCATGCTAACCACGAGCCAGCCGAGAACAAGCGCTACTACGATCAATTCATGGAGTCG
CCCCCGTTCCCATTGGTGTCTGGTGGGTGGAGAGAGGAAAACTGCATGGTCAACATGATCATGAATGCCAAGCACTCCGTGCAGCTAGAAAGCCAAATCA
TGATCTCTGGTGGCTCGCTGCAGCACAACCGCATCTGCCCTGCGATCGTGGCGCGTATTAGCCAAGCTCATCGTAAGGGTGAGCCGTTCCACGCACTCAT
TCTGACAAACGCGGCCCAGAAAGACGAACCATCGTTCCTGGCACGCACGTACTGCACGCTTTCCATTCAGTGGTCGCTCGAGCAGCTTGAAGACTGCGCG
CTGGCGTACGGCCTCACGTTGGATGAGTTGTGGCAGCATCTTCAAGTCGGTCGTCTCGAGCATGACGGCGTGTTGATCAAGGTGCATTCGAACATCGTCA
TTGTGGACGGGAAATACGCGCTGAGGTCGTCTTCAAATTTGGCTGATCGTAGCCTGAGCGCACGCCCGAACGACACCGAACTGGGTCTTCTCTTTTCGGG
GCCTTGCGTATACAAGCTGCAACAAGACCTTCTCAACATGTACTTGGGCACGACTGGCGAGATTTACTCGTGGGCCCAAGTATTTGAGCGCATCAGGGGT
ACGCCGATGAGGAAGCCGACCGGAGTGATAAAGCCGTTGGAGAAGAAGACTTGGAGTCCAGTGTTCACGTGGTTCATGATGAACGTTTTCATCTATCTCA
GTGAAGGCGCAACAGGCGGCCGCGTCAAGGTGACGTACGAAACCACGGTCATTGGCGAAGACAGACACGAGTTTGAAAACTAAGAGTGCAAGAAAGACTT
TGATGGGGATACTGCAACTCGTTGCGTGCGATAAACTCACTTTCACTAATAGCCCATTTCCTTGATGAGGGTTTTGTAGCTCGCTCCTTCGTTTGTGGTT
GTCTTCGTCTCCACTGGTGATGCAGATCTACAACACGACAAAGCGCCATACAAGTTAGACTACTTGAGTGCCGACAACTCAGCATGACGGTGTGCACGTA
CGTCTTCTTCGAGGGTAACTTCATGCCTAAGAGTTCTAGTAACTCATTTCGAGCAGAGCGCACCTGGAAAATCTGCACAGATGTTATTTGTCACGCTTTC
TCGTTAATCTGATGCAACCGTGACTTACCGAAGCGTCCCATGCTGTATCACTCAAGATCTCGACCACGGCATCATACTACAGACACATAATACCTCATTA
GCGCATGCAAAGACAAGAAAGCGAGTTCTACACCACCGCTACTAACCTTCTCCTCGTCAACGATCTCATCGTGAAGAAGCAAGCGCGTGTAGAGTTTTTC
TGCAGTCAGTTTTCGCACCTTCGGGAACTTGTGCCCGAGGAACAGCACGAGAGCTCGTAAAGTCTTGGTTTCTGTCTCGGGGTCGCTTGGAAGTAAGCCA
ATAAGCACACTTATTGCGGCACTAAGCTTGGGGACTGCAGTACATTTCTGGATTTCATCACGTAGCGCAGTATACAATCGTTCTCCAAAATCTGTTGCTG
AAGTACAACCATCTTCCGTTTTCCGTTCTTCAAACAGGAAGCGTAGCAGGTTTGACTCAAGTAGCAGCGCCATCGTCTTCATGAGGGGAATTGTAACGCG
ATCGTCCTGGTGGTGACGGGTCAGCAGCGTCACCAAGAAAAAGCTGAACCGATTGAGCAACCCAAAGTTTTTCGCCTGCAAATGTGTTCGCACCCATTCG
AAAAGAGCACTCTTGGAAGCCTTTACGACACTTTCAGTCAAGCCACCCACGCTGATCACAAGACCCGCAGCAACTTCCTCCATGAATTCTGGGATATCCA
TCATTTTCACAACCAATGGAAACGTGTCGTGGGCCATGGACCAGTTCACTGTTAGCGTCGACGGGAATATCTGCTTCTCGAGCTGAAAACGGTCCGGGAT
ACAGTCAACACGAGGGTTCGTTGAATGGAGCAATCGGAACAAAATGCTACCGGCGGTCATCCTCATGTTGTCAAGTTTCTCTGCTAGCTGTTTCGCCAAC
GCTCCGAACTGTAGTTAAGCACATGAATAACATATTATGTTAGTTCGGAACAAAACGAATCCTCAACGGTAGTAGTCAGCTTACAACTGTGCCCACAAGG
TCCGGAGATAATCGTCGAGCAAAGGGCATTGAAGATGCCGATTTCACCAGCTCATCCTTTTCTCCAAGCTTGATGCGGTCGGCAATCTCCGGAATCTGGA
AACCGATGCTGCTGTCACTATTTTGACAAGTATCACCTAAGTCCATAGACAACCTCTTCGCGTGAAGAAGCCCGACTCCCTTGGGGCCGAAGTAATAGTA
GCCCAACGCTGGCTTCTCAAATTTAACATAGCATAGCGGGTCCGATTCCGACATACCACTGATCTCTTCGATCTTGCGCTTTCGGTCCGATAATCCATCA
ACAATTACACCTTGGCCATACTCTGTCCTCGCAACTGCTCCAACAAGACGGAAATGTTGGTTTTGCGCGTGCGTACTTTCACCAAGAAGCAGCTTCTCCA
AGCCCAGCATTGCTTCCTTGCGGACCCAGGAGCCGACATCTCCACGTTCGTCTAGCCGATAATCTTGATGGACACACCGGACGAGCGTCTGGACTACGGC
ATCCTCCATACCGTTGAGATCTAGCTCAGCTGGTGGTCGAGAACTCAGGTCAACTAATGCTTGGACTGCTGCTACTCGACTGCCAGGATCTTCGTCTTCT
GTAGCAGGACCCTGCAAGGATGCTGCTCGAATCACAGCCCCCAATACTTCCTCCATGCAAGGTTGTACCAATTCCTTTGAAGCGACTCCTACAGCACGTA
GAAATCCTCGCCGGGCAGCTACGTTTGGATTTGATACCTTGACCGATACACCATTTTCCTTGGAGACTATCATGATCCCCGAGCTGATGTATCGCGGTAC
CAATGCTTGCATATATTTTACGTGGACAGGACTGCCCTTCTCGAATATCCTAGGGCAGTACTGAGCTGTAAAAGCGCCAAATGCGTCAATTGCTGCATCA
CGGACACCTTCAGTCGGATGAACAAAGCACTCTTCTAGCATTGATAGATACTTTTTCACATGAGCAAATCCCAGGCTTAGTCGAGAATTCGAGATCACTT
CAATCACATGGCATACAGCAGTGCGGATCATCTCACCACCGCGTCCTCGGAACAGACGTCGCTTATCCACCTCAATCGGCAGAATCTTGACCTTCTTCTG
CAGTTCCCCATCAATAAATACTGGCACCTGAGCTAGGCAGGTTAGCAACTCCGCGATGCTGATCACCGCACCATGTCGAACGATTACCTCAGCATCAGGA
GATAGAGCAGAAGCCAGCAGCCGAGGAAAAATTCGAGTCATAGCGTGTGGCGGGTCCAACGCTCCTATCTTTCCTAGCGCCGAAGCAGCGAGGCTACGAA
TTTGGACGTCCCAGTGAACAATTTTCGACTCGATGAGATGTTCCAGCAGTGCATATCGGTACTCTGGATACTTCGCAACAAATACACTCACATCCAAGAA
GGCATGGCGTAAATTCGCCACCGAAGAGTAATCAGCTTTAGTGAGCAGATCGATGCCATTCGGAAAGTTCGTTCGTCCTTGTCGCCCAACGTTCTCTTGA
AACGCCGCAGATGCAGCTCGACGGCAGTTCAGTTCGCGGTCGAACACACAGTTGACAAGCATCGCAGGCGCGAGAACTTGCTTTAACCAAGGCAGCAGCA
GCGAAGGTTCGTAGGCTCGCGCAAACGACCAACATGCATAGCACGCTGCATCACGCACGTGAGATCCAATACTGTACGTACCCTTGCGAATGTCGTACTT
CAACGCATTAGCGATGCACTCTACCGCATCGGGAAGTCGCTGGGGTAGTAACACTCCACGGCGTGCAAGTTCTGCCAGCGCTAAGCTTGCTCCATGCCAA
GCTCCATCTCCCTCAGTAGCCACGAAAAGCTCGAGCACGGATTGAACTATATCGTCAGCAAACTCATACGGCAGACGCCCAGTGATTCGGCCGATTCCCT
TGGCAGCCGACCAGCGCACCACGGTATCTTTGTCTCGCAATCCGCACAAGAGAACTTCTACTATCTGCTCAAGTTCTTCCACTACTTCAAATGTATCGTC
ATCTTCGTCATCGTCGGAAGCATCTTGCAGACGAGTTGGCGTAGAAGCAACGGTGTTGCCAGCCGTCAAACCTAGAGACTGCATGTTCAGTTCCAGCGAC
CGCAGACCACGACTGTAGCGCCACGACCGGACCTTGGGCGGTAAATACAGCAGCCCTAAGCGCTGCACAAGCTTCACGCTGAGCTTCCGGTGCAACGTGC
TGCTACTGGGTCGGTCCGACCGAGCGTTATCCTCAGTGAGATGCGCCACAAGCTTCATCACCGTGGCAAAATAAATGCGGCTGGCCTCGATGTGCTGCTC
TCGAGGCGAGTTCTTGGCAATATGAGCCAGACACAGCATAATGCCCGTGACCTTGAACTGCAGCACGCGCGTGTCCTTGCCCTCCGAAGCAGCCATGAGC
TCTCTGTTGGCCCAATTCAGGAACTGCGTCAGGTAGTGCTGCTCCATGTCCGGTCGGCTCAGCAGGCGCGACAGGCACACGGCCGCGGCGACCTGCGTCG
CCCCCGGGTCGCTCAGGTAGTCCTTGCACAGCGTGACGATGTTGGCCACGATGGAGGTGTCAGCGGACGAGTCGATGGTGGTGAGGTCGAAGGGCACGAG
GCACAGCATGGACAGCCACAGCAGCAGCACGTAGCGCGTCTCCCAGGCCGCGTGGTCGGCGCGGTCCTGCGACTGCAGCAGCTGCAGCGTCGGCTCGAAG
TCGCTCACCTCGTGCGGCAGCAGCTTCACCAGCGTCTTGTAGCCGCGCACCTTGCACAGGTGGTACACGAGCTGGAAGAGCTTGTGCAGCCGCGGGTTGC
GGTACACCTGGCACGGGAAGGCCACGCCCTGGGCGGCGTCGGCTTGGGTCTGCGCCCTCTCGGCCATGACGCGCTTGATCTCGTGCACGACGGGCGCCAG
CATCTCGCGCAGGTACGGGTCCAGCAGGTGCGACTGCTCCAGGTACTTGTCCAGCTGGGCAGCAGTCCACCAGAGACAGTTAGGCGGGGGAGCACGGATC
GCTAGGGACGGACGGACGTACGGTGGAGGTGACGGAGCAGTGCGCGGCCAGGAAGTCACGACTCACGTCGCTCTCGGGCGTCGGCGGCCGCGTCTGCGTC
ATCTGCAGCAGCAGCTCGCGCACCTGCTCGCGCTCCTCGAAGAAGCGCCGCTCGCTGCAGCTCTCGCC