Description :
From Genome Similarity Track
Location :
Scaffold_554:11239- 18778
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_554-fgenesh-gene-0.0CG5013-PA
Pytve_DAOMBR484maker-pve_contig_554-snap-gene-0.15Glutamine-rich cytoplasmic protein (Eurofung)
Pytve_DAOMBR484maker-pve_contig_554-fgenesh-gene-0.1Pc20g04080 protein
Pytve_DAOMBR484maker-pve_contig_554-snap-gene-0.11Conserved gene of unknown function

Sequence
7539 bases(100 bases per row)
CGATCATTCCGCTTCGAGCTCGGATGCCCAGCGCCAGGTGCAACGAGCGCATTTGCTGACCAAGTACTCGGACACGACAGCAATGGGCTGAAGCGACGGC
GGGTTGACTGCGGCAGACGAGTTGTCGACGTTCAGATGGTGGAGCTAATCGACGAGCTCGATCACGCGGATGAGAGGGTCGAGCAGCAGCGGCACTACGG
CCTCTTCGTGTGGCCGTCCGCATTGGTTCTCGCGCAATTTATTGCACTCGAGTGTCCGAGTTGGCAAGGCAAGGTCGTGCTGGAGCTCGGTTGTGGCACG
GCGCTGCCTGGGATTCTCGCTGGCCGATGCGGCACCCCGCACAAAGTGAGGATACAAACGTACAGGGCAATTCCCAACAAGTGCTGAACGAATGCACAAT
GGCGATGTCTTCGCAGGTGTACCTGACAGACCGCAGCGATGCCACGGAAACGAGACGCAACGTTGATGCCAACATCGAGCTGAACGGTCTTGGAGGTGTC
GCCGAGTTCATGGCCCTCAACTGGGGAGACATGAACGTGCCAGCAAACGTAGCCCGCGTATTCGAAGCAGTCGACGTGATCTTCGCAGCTGACTGCTTCT
ACCAGTCTGAGGGTGAGTCCAAACGCGACTTGGTCAGCGCACTCTCGGGTATCGTGTTTGAGAGCTGACATCCGCGTTGGATTGTCGATTGCAGACTTCG
AAAAGGTCATTGCCACAGTCGCTTTGATATTCCGCAGCAACCCGTCGAGCTGCTTCTTCACCACGTACCAGCTACGGAGGTGCGGACCACATTCTCCTTA
TTTTACTAGCTAAATTGGTGCTCAACCTACAGCTCATCATCGATTCTATTTAGTCTCACACATCGCTGCATTGGCAACAGCATCCATCGGTCGATAGCGC
CGTTGCTTGCTCGCTGGGGAATGACAGCCAGAGCGATCGACACATCCGGGTTCCTTCGCTATGAAGCTGACCCAGCAGTCGGCGATGAAGACGGCGCTAC
CTTTGAGAATGTGTTCCTGTACGAAATCCGTCCGGGGAAGCTCGACACCAATGCTGAAGCAAGCACGAACGGATAAAGCAAACGCAGAGGCCGAACAGTT
GGCCACGAATGTCTACTGTAGTTTTTGGACAGCTCAGCTTCGCCTTTTAGAAATAGCTCTCACGGAAGAAGGTAGAATCGACCTGCAATGCACAAGGACC
CATCGTGCATGCTCGCTCGCCATCCAAGGCGGCAAAGCCCGATTGATCCTCGAACACTGTGTGCCTTTCGCCATCTAGAAGCTGCGCGGTGCGCTCTGGA
AACAGCTCCTTCAGCCTTTTAAGCGAAAGCGTAGCGTATTATCTCGCCCGGCGCAGCGTCCATCCGCCACTGTCTCCGTCCGTAGGGGGAGCAGTGGCGA
CGGCTGCGAAAGGCGAGTCAGACCATGGGCTTCAGCGTCTGCTCGCTAGTTCACAGCGGCCGGGTGAGGAGGGACCTTCCTCAAGCGTAGCAATTGTAAC
ATCCTCGCTGTTCATCCACATACAGATACACACACGCAACACTTGCACCGCTGCCACTGCCACTGCTGACAGTAGATTCGCAGAATGCCAGATTCCAGAA
CTCCACACTTTTTCAACCAATCACGTCAATTTATCTCCACATTTCCACCAATCCTGAGGCGGAGAGTCTGTGGTCGTGCGAGCCGATCCTGTTGGGTGAC
ACGGATCGCAGTGGGCATTGCAAGATTGCGTTCATTCCTGTCGCCACCATGTTCTCTCGCGTCGCTCGTGTCGCCGTCCTCGCGGCCGCCAAGAAGGCGC
CGGTCGCGCTCGCGGCTCGCCGCGTTGCCGCCCCGTTCGCCGTGCGCGCGCTGCAGACGCGCGAGAAGTCGACGCTCGGCTCGCTGCTGAAGGTGCGAGG
CGATGGTGGTGGTTGGGGTGGACTGTGGCGGAATGGTTCTAGGCGCTAACGCAGCTACAAACGAACGGTTAGCGCGAGGTGGAGGAGGAGAAGGAGAACA
GCTTCGAGGGCGAGGAGCTGACCGAGCTGCGCGCCAAGATTGGTGAGGTGTTCCAGATCAAGGAGGCTGACGGCAACACCGAGGTGGTGCTCGAGGGCGA
GGTGCAGGGCGACGCGATCCGCATCAAGTTCGACGTGCAGGACGTCGTGGAGCTCGAGGAGGACTACCTGGACGAGGACGAGGAGGGCGAGGAGGACAGC
GAGGCCCAGTACGACGACGAGGAAGAGGAGCCCGAGGACGAGCTCCCTGGTATCCGCTTCGTGGCTGACGTGACGCGCAACAACCAGGGTCTGCAGTTCG
AGGGTGTCGCCAGCAGCAACCTGACGGTCGAGCGTGTGCGCTTCCTCAACAACGCCGAGACGGATGCTGACAAGGACGACCTGTACGCCGGCCCCAACTT
CATCGACCTCGAGCTCGACGTGCAGGAGCAGTTCTACAACTACCTGGCCGCCCGCAAGGTCGACGACGAACTCGCGCAGTTCATCACGCAGTACGCTGAC
CTCAAGGAGCAGCGCGAGTACCTCGCCTTCCTCGAGAGCGCTTCCCGCTTTGTCAAGCACTAATCAGTATAGATGTCGCCGAAGGTGTGGCTGTCATTGC
CAGCTCGCAGAACGGTAGGATGCCGCTTGAGTGTGGCCGCTATTGTCCGACGCTAGGACGGCAACAAACCACACACACACACACCTGACAAATGGAGTAT
CCTCCATGCGTTCGCGTTCTCATTGACATCGTCGAAGCGGGTGTCACGATCTCTGCGATCCGCGCTGACTACCCACCGTTGTCTACAGTACCTGCACGTC
CGAGTGTCTAGCCTTGCATACGAGACATCATGCTCTGCATCAGCTGCGACACCTTCGGGTTCGACATGTGGCGCATGGCGGCGGACGGGCCTTCAGCGTC
GACATCGCGGAAAAAGTCCTGCAAGTCGGGGTCCGACCGCGCGGCCATAAGCTCGGGGCTGTTCATGAGCCCACTCATGTCGGGCATCCCGCCGCTGCCT
GCGCCAGCTCCGGCTGCAGGAGCACCGCCACCACCGCCACCGCCGCCCATTCCGCCGAGTCCACCCATCATATTCCGCATCATGTCGGGATTTTGCATCA
TGTTCTGTGCCCTGTACAAGGAGCGCACGACAAAGTTAAGCGGGTCAGTAAGGTTCCTCACTCGCAATGAAAAGAAACACCGCAAGCGTACATCTGCATC
ATGGCAGGGTTCTGCATCATGCTCGAAGCCATCTGCTGCAGCGCCGGGTTGTTCATGAGATCGGCAAGGCCACCGCCGCCGCCGCCACCGCCGAGCATAC
TGGCCAGACCAGACAAATCTGGCATCCCTCCGGCTCCAGCACCGCCCGATGAAGGAGCGCTGGAAGAAGCACCAGACGCCACGGCCTGCTGCTGCTGCAG
CTTCCGCTCAGCGTCCGCAAGACCATCGCGACAAGCCGCGTTGGCACTGTCCACCTCCAGTCCGCGGCGGAACGAATCGATCGCGCCTAGGTAGTCCTTC
AGGTGGATCTGCGCGCCACCCATGCGGGAGTACGCCTTCACGTACGAAGGCTTCAGCGTGATAGACTGCTCGCAGTGGTCGATCACGTCCGTGTACTTGC
GCTGGTACATGAGCGCCGCGGCCAGGTTCGAGTGGTAGATGTGCGAGCTCGGGCCATCCGGAGAGAACTTTAACGCCTCACGGTACAGATCCGCCGCACG
CGAGTACTCCTGCGCGCTTAGAGCCGCATTCCCCTGAACCTTGAGCTCGTCAGCCTTGGCCTCCTTCTCCTCCTTCGAAAGAGACGGCTGGTGCGGGAGC
AGCACAGAACAGGTGAGCACAGTGCTGCATCGCACGGCGCAGGATCGAATGGGGGAAGTACCGCAGCAGGCTTGACGTCGCCGAACTTCTCCTTGAACTT
GGCCAGCGCCTTCTTGGTTCGGTTCGCGTGCTCCTGTGACCCCGCGGGAGCGCCGTTGAAGAACCCCTTGTCGTCCAGCTTGGCGACCCACTTCTTCCAC
AGCTCTGGGTCTGTGCCACCAGCAGTCGCAGATGTTAATCACATGCGCTCTTGAATCACTAAGCAGCTAACCAGCAACGTACTCTTAGCAACGACAGGGT
CCTGGTCCACGGACGGATCGATAGCTGCAGCCTGTGTTCACCATTGCGAATTAGTCACTTCAGTCCTCGGACACCCCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCTTCGCCGATCTCTAGCCCCAGAGCTTGCAGACCCGCGGCGAAAATGTCCTCGAACGACGTCGCGCTGTTCACCACGAACTGGCACC
GCTGCTCGGCGTCGTGCACGTTCATTCCGAACGCCTCCCTGTCCGACCACAGACAGCCATCACCACAGATCAGACTCGCCACATTTACAAGATTCTACAC
TATTACACGGTCAGCATCGCGCCGCATCACATACGAGAGGCACTGCAGGCCGACTTCCACGTTCTCCGTGTCCACGCCCTCGCTGCGCTTGAGGCCCTCG
AGCCACGTGAGCGCGCTGAACAGCGCCGCCTTGCTCTTGGTCTCCATGCTTTGACGCGGTTCTCGCAAAATGTTCCAACGGGAGATTAGTCAGGTCACTT
TGGCGACTGGCGCGTGTCAACCAAGTTTCGTCCAATCATAGAGCCGAAACATTCAGTAAGGCGACCACATTGGCGGAAATTATTGGATACATCTGTGGCA
ACTGCACTTCAACTCGGAAGAGCCGCCACAGCATGGAGCTGTTCGCGAAATCGACAGAGGACGAGGACGGCGCGAATGGCGCGAGCCTCGCGGCGATCGA
GGAGCATCGCCGAGGGGTCAAGGTCAGTCTCCGCACGATCGTCAGCAGTCTGCGGGCGGCAGGCGCGGTCACGGATGGGTACAACGCAGCATACTTTCTC
AACCAGGAGGATCATTCAAGTGACACCGCTGTGCATGAACCACTGTTCCGATGCGTTCGTGTGCGGATTCCGGACGATTGCGTCGCGAAAGCGGCGGCCG
ACCGATTTGATTTCGATCCGCCCGATAATCTGTTTACAGAGTGGAAAGTGACGCCGCTGGGTCGAGTCATGTGCCAGCGCGTGTGGGCAATATTCGACGC
GGACAGGGACGATGCCTGGAGTCACACCGAGTTTCTTGAATACATGACTGCGATGGAGAGAAATGGGCCATGGTTGGAGTTGCACAAGATCGCGGACAAC
AAGGAGACGTGGCAGATGTACGTGAGCGATCTTTGCGAGGTCACAGCCGAGTTCTTCATGACTTTCGACGGGTTCGTGGCGCACCGCGAGGCCATTCAAG
GAGATCGTCCACTGGAAAGCGACCTCAGTATGCTAGACATCAGGGTTGAGTGGCCAGAAATAGTCAGAGTCGAGCAAGCCAAACGGATATTTGACGAGTG
TACTGGCGCAGAGCACATGATTCAACTTTCGCGACTGCAGTACGTGTTGGCCGAATGCGGATATGTCGCCACACAAAGCGATATACAACAAGCCATCGAG
CAGCAGCGTCGGTTCGGACGGTGCTTGCGATCAATACGAAACCTGAAGAAAGCCCTGCGACTATTTGGATACTATCAGCGATCGGATCTACCCTACGACA
CTCCAGGACTGTCCGAAGAGCCAAGAATCTGCAAACCCTCGTTCCTTCGCCTTGCATTTTCCATGTGGACTCCACCAGACACAACGGTACCGATATCTTG
CTACCCTCCACGGACCACCATGTTCCGTCGATCTAAGTTCCTAATATGTCTCAGAGATGGCGCGGGGTCTGCTTGAGTGCGGTGTTGAGTTCGTTCAACT
GGATTAATCGGTGGAGGCGGAATGTGTCGTGGGCATTCGGGTGGGTTCGTAAGGCGTCTCGAACAGGCTTGCTGCGGACAAGCTGTCTGGGCTCCAACTC
CGAGAGAGAACGGGGAGACTATATCTTTAAACTTGAAGTGGGACGCACATTCACCAGTAGATCGACGATCCACATCACGTACAATGCCGATGCAGACTGT
GCGTCTCGATGTGCTTTTGTTAACCACGCCGTTCAGAACTATCTAACCAACAGGTTGTCGGCACTGAAACAGCGGCGTCTACTCTTCACGACCTCAAGTA
TCTTGAGCGTGGCGCGGAATGCTTTCTCTATGTTGATATTCGGTGCCGCAACGGGACTCGAGGTAGGTGTCGACATTGCCTGCCAAACGGAACAAGCCAC
TAAGACTGGTTTCATACTGAACGAACCGCAGAGGCTGATATCCAGTTACTCGCACAAAAGCTCACGTGGGTAATCGATGAATACTTTCGCGACCATCTGG
AGGCGTTGCCGTTTTTCTTCAAGTGGTTCGTCACGATTCCGAGCAAATTGCAGCTGCGTTCTGGTCCCGGAAACCTTGGCAGCACAAGTGGCTCTGGGTC
TGGGGGATCCGGATCCACTGTGATTCGTCTTGTTGTCTTGTTCACTGGCGGGTTGGACCTGTACCAAGTCATGCAGAGCTTGAATCTCCCGTCGTCGATG
CAGTTTGATCATTTGCTGCAGCGATTGTCGCTGCGACTGCTGTGTAGCTGTTCGCTGGAGGATCTATTAGCCAACAAGCGCTTGATACTTGGGACGCAAT
GGAATTGCCGAGGTCAGTTCGATGTAAGATTGAATCGACAGGCCATAGCACAAGTGCTGCTTCAGCTTGTCGCCCAATTGGACGCTCAAGCGGTTCAAAC
GCAAGAAGTCGCTGCCTACATGGCTCGAGAAGTCTTGCAGGCTGCAGAACGTGACAAGACCGCTAACAAGAGCAACCACACGGCCGGAATGTCGGCAAAA
AGACAAGCTTCTCAGGGTACCGCTGCGTCTGCATCGACTCCCCCTTGCGTACGAGACCCGGCCGCGTTTGCCCGGTGGTGGTTACATCGCATTGGCCTGC
TGCTGCAGTATTCGCCCGAGTCAAGCTGGACTTGGACCTTCGAGAGTCTACAGGAAGTTTTGCTGGGCAACTCGTGGATTTGCTCGGTGCTGTCGCCTGA
TCAGTTCGGGTGGTGGAAGAGCGCGCTCAGCAACTCTGGCGGTCTCGCAGATGCTTGGATGTCCGCAGGCGAGTCGTTTCGAGAAGAGTTTGCCAGCTCG
AAGTATGTTCGAGCAATGGGCAGTGGAGGGTCCACCCAGTCACAAGGAGCAGCATCCCAATCTTCGCTCCAGTCTGGACAAGACAGCTCGCTCGAGATTT
CTATCGCATCCACCTTTCCGTTTGCAACAACGGCGTCGTCACCAACTAATTCAGTGGCACGACCAGCTCAACAAACTCAGCAGCAGTGTTACGACAGAGC
GGAAGCTCCAGAGGAAAGTGCTGAAAACCCTCGCGCCAAAACACGTGAAGAGCAAGAGGACGAGTTGTTGGAATGCTATGAATTGTTCGCCAAACACCTC
GTGGGGGTTCACGTGGTTCGCATCGAGGCAGGCACGAGCGGCCTGACCTGTGTGCTCGAGGGGTGGAACCTATTCAGTTTGCTTCCGCGCATGTCTCCGA
GTCAGCTCGGGAGAAGGACGTCGTTCGTTCGCACGGCCA