Description :
From Genome Similarity Track
Location :
contig_41:112374- 113768
Transcript NameFunction/comments
g8472.t1hypothetical protein
g8473.t1hypothetical protein

Sequence
1394 bases(100 bases per row)
CAACTACACGCTCAGGGTCCACCTGCAGACCAGCACCAGCGCGGGCAACGGCCACCACTACCAGCCGCCTGATGTGTACTAGGCCGGCCGGGCCGCTACT
AAGCCGGTTGGGCCAGCCAGTGGCCGCCACTTGGCCGGGCCTTCTATAGACAACCAGGCAGCTCTCCTCCAGTTCTACTACTAATTCATTATTCTATGGG
CCCGCGTCGGAAGTCGAGAGCTGCCAGGGAAAACAAGGCTGCTGTTCCGACGTACTTTGGCGACTGCGTGTTGTGTGTGCCCGTCCGCATCGTCGGGCGA
GTTCATTTCCCGGGGTGTTGCTGACTGGAGATGGATGCAGTAAGGACTGACGTGGAAGGCCATTGGAAAGCATTCTACGCTCCGTGTTGCCGGTCTGATA
CCGTGACCACTTAGTGCATCTTCTCCAACTACTGACCGAGCTACGACCCAACGCAGGACAGCAACGAGTCCTGAGGACTTCCTTACATTATTTCGCATCA
CCAGCATAAACTCCAAAAACATCGTCGTATGCCAACACCATGCAGTTTCCATCGCATTCTTCTACTTCTCTCTAGGCCGACGCCATCTTCGTTTTGTTCT
TTGGCGAGGTCGGACTCGCAGGCGCCTCCAGTTTAGCGTCAACGTTCTCTTCCTCGTCCTGCGTTTGCTGGAAGTCGTGTGTGAGCTGCGAGGCCGAGGC
AGCGCGAGCCCGTGCGATGTCCTGGAACCCGAACATTGCGCGAAGCTCGGCACGGAAGACAAAGGCGATAAGCAGCAGGATGAAGGCTGCGATCGCGGCT
GCAATCTGGCGACGCTCCTGGGCGGCATGGTACTCGTCGATGTGCGCGTAGCGGTTCTTGAGGTGATACGGCAGCTCAAACTGCGACCGCTTCGGCCAGA
TCGACAGGAAGAGTTCGTGCAGGATCTGACTAACCGCCGTCGACGGGTTCTTCATGTCGTCGTTGATGCAGACGAACTTGGTGCGCCGCGCACGTGTGCC
CATCATTTGCTTCCAGGCAAACTTGTAGTTGTCGCTCAGCATGTGGAACGTCACCTCAGTCTCCGGCATCAGCTCCACCTTCGTCTCGTACCTTACGTTT
TTGATCAGAGCGTCACGCACTGACGGGCATCGCTCCAGATTCTCCAACGTAATGTATGGCGTCAACGTCTCGCTGAGTCGCAGAGTGCCTTCTGCCGTGG
GGATCTCACGCACCTTCTCACGCTTTTCAGGCTGCACACACTCGCGGACTTCGTTCACAAAATCTTCAGGCGGTGCGTCTCCGTGCGCAAGACTCGCAGC
GGTCAATACCTCATTCTCATCCAAGATTCCGTTGCGGTTTGCGTCCAGGTACTCGAGCCAGATCTCTTCAAGCGTGTGAGGATGGATCTTCACG