Description :
From Genome Similarity Track
Location :
Scaffold_609:11237- 12682
Sequence
1445 bases(100 bases per row)
TGACGTTTAATATGGTGTCGAATCGACCACTCGTCTAATCAACCAAATGACGGCATGTTTAGACGAGTGtttcaagctgcaggcaAAAATACTACCGTAT
TATAACATTGTAATACCAACAGCGTTAATTTTTGCTGACTGCAGAGCATTCGAAGTCAGCTCATTTAATATATATATGGATGTACATTTAACTTAATGCA
TGCTTTTACTAGGTTCAAGTGAATTGCGGCAAAACGGAAAATATCCAGCCGaaagttttttttaatatCAAAAATCGATTCGAAACGAGTTTTTGGTATC
TTTTTACCAAAATTCACACTCCGGTTTTAGTCGTTATTAATACTGACCAAGTTATGCGAATATGCCCTGCCACATTTCGAAAAGGCATAAAAACAACGAT
GGATTTCTCTATACAGAAATATCACGATCGACAGAAGATGAACGCTAACAAGAAGTCATGCAATGACATCAGTGAGTTCAAAACAAATTCCTTAGTTATA
CTGTCTACAGATAACTTCCCTAGACATGCAGTCCCAGACTTCGCGCTTCATCAGGCCATTTCTACAGCGGGGTTGCGTAACAACGTGCTTTACACAGAGG
AAGATTGGGTGACTCACCGAGTCTATAGACTTCGTATATCAGTCGGAGTTCCGACGGCTGTAGCGTTCTTTTATAAGAACCAAATCTAACAGTCCAAAAT
TGCCTGTTTGGACTCGCAGTCAGCTAGTTTTTAATTAAAGATAATTATTTTATTTACTCGCAAAATGTGAACTGAATTGATGTTATTAACTTGGCAAAAA
TGCTCTTTTCTAAATGTATCGAATTAACTATACTTTAGCTAATTACACTTATATTGCAAAAAATGGCGTTGTGTCCATGTACTGCTGTCAGTACTGGGCT
CAGAGCACTCATGGGTACTATGTACCAAGATCTATGGATGGAGAGATCCGGATAAACTCATCCGGAGAATATGATCTAATGTGTGGACCACCTAATGGAT
ACATTAATGTAATCCCGTTGCATCCTCCCTCATCAAACCGTTGGCACTCCGTTTCTCGGCAAGCCTGGCCACATACACCCCGTTCTCGATGGCTTCTTCG
ATAAGCCCGACGCAGGGCGTCATGacaacaacgtcgtcgtccggGCTTGACCCGCTACGTACTCCGAATTCGTTCCTAGAACTTACGCTGGTCCACGAGG
GCTTCGGCTCCTTGTGCAATAtgccacttcttcctctcaATGAAGATGACCCCATGGATCAGAATATCGCTACCAACGACTTGGATGGGGTTCAAGTCCG
GCAGCCCGCTGCTCAGGAATTGTATCGTCCCTATCATCCTCAGGCACGGTGTAGCAGGGCTgcacaagtatacatatgtatatgtatagctatccggcag
ggattgcggataggctgtatacatatgaagcaggctgtctGTGTG