Description :
From Genome Similarity Track
Location :
Scaffold_646:11235- 12797
Transcript NameFunction/comments
g13023.t1hypothetical protein

Sequence
1562 bases(100 bases per row)
CTGCTGCTGAGCCTGTTGCTGCAGAGGAATCTGCTGCATCTGAGCCACGGGCTGCGGTCCGCGAGAAGGCGACTGCGCTGCAACTTGGGCATTCGCACCT
CCGCGAACACCAGCGCTCTTTGGGGTACCAGAGCCTGTCGGGAGCTGACCTTGCGCCGAAGCGGTAGCGGGGCGGCCAAGGTCCATTGAGTACTGGCCAT
AAGAAGCCTGGTACAGACCAGCGCCGTATCCGATGTTCATCTTGTTAGCCTGTGTCGCAGCTCCTCCTTGAGCTTGGAACGGTCCTCCTTGGGAACGAGT
AGGGGTGCCACGCTTGACCTCATCAGGCTTAGGCAGAGACGCCGGCGACGGTGCCGATGGTGCATACCGAGGAGACTGTCCCGTGGTAGGCGTGACACGA
CCCGAGTCTACCGACAGTCCAGGAGGCGCAGAAGTGGTGATAGCCTTCGTAGCAGTTTTCTCCTGACCACGCTGCTGCTCACTGCGTTCAGGAGACAGCG
CCTTTTTGGGCGAAGCGGCCTTGGTGGCATTTCCCCAAGCGCTTTGCGTGGTAGTTGTCTTCGTGACGGTCTTTCCGCCACTGTTCGAGCTAGTGGTTGC
GGTTGTCGTGGTCGCAGAGGCCCAACCACGCGGCGATGAGGGCTCCAGTTGATCCATGCCGTTCAGAGAGAAGCTACCAAACTGCAGCGCCATGTTCGGT
GTAGCAGCACTGTCCCATTTACCCATCTTGAGGTACGGTCGAGGACTCGTCGAAGCAGAGCTGGTAGCGCGAGGCACATCGATATCCTTCGGGGAGCCAG
GCACAACTGTCGGTCTCGCATCAGCAATCGGCGATTTGGGTGCAGGGGTGGTCTCCGTTCTGGTACCAGGAGGAGAGAGGACAGGGCTGCCACGTGCCCA
CGCGTTCGGTGTCGAAGCCTTCTTGGCCTCCGTGGCAACGGCGGGGGCAGACGAAGACCACTCGTCCATCGTCGACGTCGAAACATCCAGGGATCCCCAG
CCAGCAGCAATGTTAGAGGTGGTCGTCTCCACGGTAGTCTCAACAGTCTTGGTCTTCTTCTTTTCCACGGTCTTCTTCGGCGACGCCTTGGGGCTGGCCA
CCTTCGCCACAGTCTTCACGGTTTCTGTCTTTTCGACAACGGCCGCTGTTTCTTTGACTGGTTCAGTAGTGTTGGGTTTCTGTGTCTTCTTGCTCTTCTT
GTCCTGCTGCACCTTCTTCTTCGGGCTGGCTGGCTTCGGGGCCTCTGGTGTGGTAGTAGTGGCAGTAGCCTCAGTTTCTGAAGCAGGCGCAGTCGGCTTC
TCTGCCTGCTTGGGGGCGGCCGCAGGCGCGGGTGTGATAGCGGGCTCTACAGGCTTGGGCTTGGAGGTGACGCCAGTAACATTCAGCTTCTTCGTCCATG
CGCCGGTCAGCACTGGGTAAACAACAGGTGCCTCTTGAACGGGCTGCGTCGTTTTAGTGGGCTTCGCTCCGCGGTCCCGCTTGGAGTCCTTGGTCGCCTG
AGAGGACTGCTGCACACGTGCTTCGTTGGACGGACTGGAGTCGTCAGTAGAGATGTTGTCGT