Description :
From Genome Similarity Track
Location :
Scaffold_35:112344- 114094
Transcript NameFunction/comments
Phyra_78845secreted RxLR effector peptide protein, putative

Sequence
1750 bases(100 bases per row)
GTCGTCGTACATCATCACACTGGGACGCAGCAACGGGTGGGGCTGCTGATACGGCACGGACGTGGTCTCGTAGAAGAGGTTCTCGTTCTGAGCCATGAGC
ACCAGACGGATCACGTGCGCGTAGGCGACCGAGGTATCGTGCAGCTCGAAAAGCAGCTTGACGACGCTGTTGAAGCGGAACCGCGTGAGGCGGAACCCAA
ACTTTGACAGCACGTCTCGAAGATCGTCGACCTCGATGAAGCCGGTGTTGGTTGTGTCTCGGGCTTTCAGCTCTGTCTGGAGGTCCGAGATGGCCAGCTC
CTGCTGCGTGAGATGCTGGAGTAGCGTGGTCGCAAACTCGGACCGCAGTCGCACCACCTCGCTGAAGTTCTCCACCACGTCACAGAGCGTGTGGGAATCG
ATGCGGAGTATGTTGCTGACGATGACGAAGTCGTAGAAGATGTGGCGCTGCAAGAAGACGGCGTTCACTACGAGTGGGAGCGGCACCATGACTGCGGGCA
GCGTGCCGAAGTCTTCGTAGATGTCGTCCAGATCGTACACGGCACACTGCACGAACAGTGTGATGAGGAATCCATTGAGGATGAGGAGCAGCATAACGCC
GATGTGCCAGCCCTTCTGGGAGAATGAGCGGAACTCAAGGCTAGGCGACCCAGCGACGACGCCACTGAGGCTGTCTCGCGCCACTTCCTTCTCGTCTTTG
AAGTAGTTGACGACACGCTGGAACGTGGAGTTCCTCTTTCGCTGGCTTTGAATGCGGCGGTACTCGAGCTCCTCGTGGTGCTCCTGGATGCTGCTCATGA
CTTCCAGGGCCTTGTCTGCCTCTTCATTCTGCCAGGCGTGTGCCTCCTCATCAGCGATAGCGCTCAAGTTTGAGACCAGAGTGGTCTTGTTATCGCTGTA
CGCGGCAGCGTGCAGAAGCTCGTGCATGCAAGAACGGAAGTAGAAGAACACCATGATGTGGAGCAGCAGTAGCACCCACGCCATCATCATGAAGGCCTCG
ACGAGCTCGTGGCTCTCGGGCAAGTCCGTGTCCAATGTTTTGAGCACTTCCAGCAGTCCACAGATAGTCCACGCAACGAGGAGAAGCGCCACCCACATGG
ATGGCTCGACCTCGATCATGTGCGAGATCTGGTTCGCTTGAGCGCGACTGAGGTACTTGGAGAACGGGAAGAGCTGCGGCAGCCCAAAGCGACGAAGAAA
TAGGCGACGAATGAGCCGCAACTCGATGAGCTGCTTTTCGTTCGCTCTCCTCTTGGCTGCCCTGCCACAGCAGCACAGCGTTTGGAAGAACGACGGCCCG
GCCTCTTCAGCCTTTTTGGCCGCGTTGACCGAGTTGGCGAGGTCCTGTGTCGTGATGAGTTCGGCTCGGTCTGCCCGGTCGTTCTGGTTGCGGAGCAGCA
GGAACACTGCCGTCGACTGCAAAATGAGGGCGAGTGCCAGAAAGAAAATGACGAGGTCGGCCACTTGGAACGCGATGATGGTTTTGCTGTAGCTGTCGAT
GTCGGGGTTTTCCTTGAGAATCTTGAGGCCGAGACTGATCAAACCCAGCACCATGAGCTCTCGGTACACTTTCTTGAGCATGTGCTGATACTTTTGCGAG
GGGGGGAACTTGTGTTCCAGTCGGTGCAGTGCTTTCTCGAAGAGCACGAGGCAGAAGGCCAGGATGCCGAGGTGGACGAGCACTCGCCAGAACTCGACCG
TTTTACCAACCTGGAAGAGCGATCCGCCTGCCATGGTGGATTTTGTGAAG