Description :
From Genome Similarity Track
Location :
contig_41:112326- 113720
Transcript NameFunction/comments
g7198.t1hypothetical protein

Sequence
1394 bases(100 bases per row)
GAGAGCTGCCAGGGAAAACAAGGCTGCTGTTCCGACGTACTTTGGCGACTGCGTGTTGTGTGTGCCCGTCCGCATCGTCGGGCGAGTTCATTTCCCGGGG
TGTTGCTGACTGGAGATGGATGCAGTAAGGACTGACGTGGAAGGCCATTGGAAAGCATTCTACGCTCGTGTTGCCGGTCTGATACCGTGACCACTTAGTG
CATCTTCTCCAACTACTGACCGAGCTACGACCCAACGCAGGACAGCAACGAGTCCTGAGGACTTCCTTACATTATTTCGCATCACCAGCATAAACTCCAA
AAACATCGTCGTATGCCAACACCATGCAGTTTCCATCGCATTCTTCTACTTCTCTCTAGGCCGACGCCATCTTCGTTTTGTTCTTTGGCGAGGTCGGACT
CGCAGGCGCCTCCAGTTTAGCGTCAACGTTCTCTTCCTCGTCCTGCGTTTGCTGGAAGTCGTGTGTGAGCTGCGAGGCCGAGGCAGCGCGAGCCCGTGCG
ATGTCCTGGAACCCGAACATTGCGCGAAGCTCGGCACGGAAGACAAAGGCGATAAGCAGCAGGATGAAGGCTGCGATCGCGGCTGCAATCTGGCGACGCT
CCTGGGCGGCATGGTACTCGTCGATGTGCGCGTAGCGGTTCTTGAGGTGATACGGCAGCTCAAACTGCGACCGCTTCGGCCAGATCGACAGGAAGAGTTC
GTGCAGGATCTGACTAACCGCCGTCGACGGGTTCTTCATGTCGTCGTTGATGCAGACGAACTTGGTGCGCCGCGCACGTGTGCCCATCATTTGCTTCCAG
GCAAACTTGTAGTTGTCGCTCAGCATGTGGAACGTCACCTCAGTCTCCGGCATCAGCTCCACCTTCGTCTCGTACCTTACGTTTTTGATCAGAGCGTCAC
GCACTGACGGGCATCGCTCCAGATTCTCCAACGTAATGTATGGCGTCAACGTCTCGCTGAGTCGCAGAGTGCCTTCTGCCGTGGGATCTCACGCACCTTC
TCACGCTTTTCAGGCTGCACACACTCGCGGACTTCGTTCACAAAATCTTCAGGCGGTGCGTCTCCGTGCGCAAGACTCGCAGCGGTCAATACCTCATTCT
CATCCAAGATTCCGTTGCGGTTTGCGTCCAGGTACTCGAGCCAGATCTCTTCAAGCGTGTGAGGATGGATCTTCACGCGGTTGATCAAGTAGTGGAAGTA
CGAGAAGCTGAACTGCATGTCCTCCGGGTGGCGGAAGCGGTGAGCCGATGTATCTTGCACCTCCTTGGTCCAGTAATCCTTAATTTCGCTAATGATTGAC
TTCTGCAGCAAGAACGGCATGTGGGACGGCACACGACGTCGATCCGATGTCTTGGGCTTGCCAAACGCGCGGTTATACAGCTTGTTTACAAAGC