Description :
From Genome Similarity Track
Location :
Scaffold_639:1123- 8254
Transcript NameFunction/comments
Physo_145218hypothetical protein

Sequence
7131 bases(100 bases per row)
GTCAGCCATGAGCCAGCCTACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGGGCTCAACCCCCGCGCGTCAGTACGAAATCGTAACGTTCGGCGAGT
GGGAGGCACTGTACGACCGATACTGCGCCGAGTTCGCTGTCGGTTTTGATGTCATTAACGGGGCGTATCACTGGAGAACTCAGGAATGCCAGATCTGCAA
TTACGGCATGGGCGGCGGGCCATCGTCTAATCAGCCGAACTCGCGGCGGTGAATGTTCTCACAACGGTGAATGGCTTCCGCCATAGGCGTTGTAGACAAG
ATAAACATGCGCATATATACAGGTATTACAAGTATGTATACAGATTTCTACGTGGCCTATGCCCTGGCGCATTGCTGTGTGTGTTTAGACTTGCCGCTGA
CCTCTAAACCGCAACGTTCCTTGCGCAGCTTCTTCGTGTATCTCCTCAGCCTCGCCAAGCACTACGTCATTGCTGCCTTCACCGTGCTCATCAACTTGCG
TATTCGCTTCTGGTTGCCGCAGATTTAACGACGGCGCTTCAGCTTCTTCAATTTTGGGCATGACGCTGGCAAATTCAGGGTCCCCTTCTTCTATGAGTTT
CGCACGACGAAAGGCTTCCAGCAGTGCAGGCACGCTGAAATCGGTAAAATTGAACCGGCCGCCGTAGCGAAGCATCTGCGTCTCGTACGCTGCATAATTG
AAGGCCTTGAACCAGCGTTTGCGGATTTCTTCTTGCAATTGTTTCTTGCGCTGAGCCACGGCCTCAGTATAAATTCGTCGTGACTCGGTGAGACCTTCCC
CAACGATCATGCTCAGACCAAACGCAGTGACGGCAATACATGTCCCCACGAGTACGATACTCAACAGGTTCACGTCGATGAGTGACTCGGTGTTGAGGTT
GTTGAGCGTGATCATGACTCCAAGCCACAGCGTGAAAAAGAGCTGGAGCTGAGTGATACTTGCGATCAGGTTATCGGAATAGCCTTCGTACGGCTGGAAA
TATAGCAGGAACCACATCGTCACGAGGCTGTTGAATGTTGAACCAGTCGCAGACAACCGGAATGTTAGTATTGGCCCTACCAAATGCTATTACCCACAGC
ATAGACCCACCAGACAGCGAGGGCAAGGAGGACTTGTTCCACACTCCCATTCTTGACGAAAACGATCACACCACTAAGAAACAATTTTCGTGACAGATCA
ACGACTTCAAACCACCAATAATCGCTCGAATCTGTAAGCAAAAGAAAAAGTGGGGTTGAGCCAGCAGAAAATGATGTCAAAGTAGCGCGGTTACGACTTA
CATTCAGCGTAGATGAATCCTAGTCGCGCTTGTACAGTGGAATCCTATGATGCAATACAAATCACGATGTCAGTCTTTATCGACGCTACCCATACATGCT
TAGTGCTCGGGTACCGTCAAGTTCTTGCGCTTCATATACTTCGCCAGCTCCTCATCTTGGACCTCGACATTATCCATATCTCGAACATATCGGCCATCTG
CTATTTGCTGGTCTTCAACCTCCTTGAGCCACTTCTGTCTTTGGACGCGCATTTGCGGTTTACGCAGGAGTCTTAGGCGTGCCGCAACGCCGCGGTCTTG
AGCTAGCCAGATGAGTAGACCGAAGAAGAACGGGATACCCACAACCCATACAACGACACCGATGGTTGCGATTATACCAAACAATGCCCACTCCCCGTTG
TAGCACACCAGACGACGATCAGCCACGAGATAATACGTATCACCAACTTCCTGGCAGTTGTACACTGCCAATATCGTCTTCGACACGGAGGGGTACAGGA
AGAGTGCCATCCAGCAGTAGAGTTTGAGGCATTTGTTGCGGTACGTAAGGTAGTTCATGCGTAGTTTCACGCGAGCTTGCCAGACTCGAAGATTACTGCG
AATGGTGCGTTCACGCATGACGCCGGAAAGCACGTGACGCTTCACGGGACAGTTTGAATGCTCTGAGCGGAACAAACGCAGGTACGGAGTGCGAACCTGG
GACATTCCGAACTTACGGTTCAGTGCACGAAATTCCTTGAGGGTCGATAGAGCAACGGAGCTTTCGTTCTCCGAAACCCCCTTCGTCTCCCTCTGTGCAG
TAGCCGATGAATCGTGCTTGTAAAAGTTGTGGATGCGCCACCTGCTTCGAAGCAACCGGAGAGGGTTCAAGCTTTCATCGTCGTTCTGAATGGTCTCGCC
CTCGAGAACTGGAAGTCCGCAACGTAAGCAATTTCGCGGGATTAACTGCAGCTTCGATCGGTAGCTTCGCATTCCAGCGTAGAAGTAAGTAGTAATCACG
GTAAGTGCAATCACAACCATGATCACGGTCACTCTGTTAGGCAGGAAATGCAGGAAAGGTATTAGACAGCATAACAGTAGGGAAGCTGTACTAAGAACCT
ACGTGAAGTCGAAGTAAAACGTTTTTGTGACCACGCAATCAATACCGGCAATAGCCACCAAGTCCTAGATCGCAGTCACACGGGTAGATTTTAGTATGGC
GCTTTCGACCTACAGACAGAACACGTGGATTAACTAGGAAGCATACGTACCAGATTGAATTTCTGTGAGAAACTCATGAAATCTTGTATGTTCGACGACC
ATTTCACCACGAAAGAGCCTTGGAAGTTGCCAAATATTTGAAAGAACCCAATGAAAATCTTGAACTTGCTTGGGCTAACTGGGAACGTCCGAGCTGGGGG
GCTGACATCGACGCCGAACAGAATTTTCGCGTTTCGGTGGCGATACTTCTTCCAAGTTTCTCTGATCTTGTCTTTGACTCGATCCATTCTCCCCACCACC
GCCATCGAGCTTCTTAGGTACTTCATGCTTGCTCGTAAGGCAAGACTTTCACCCTTCTTAGTATTAGGAGGCTTGAGCCTCCTATCGGCTTCGGCTTTTG
CTAGCAAGCCAATTTCCGTAACATCCCGGAGATAAATGCGAACTCCATAGATGCCCGCAACAAGCGCAATACCCAGCATCACTGGGATGACGAAGTTCTG
CCATCGAACGGATGCCCGAACTTCTGCATTTGCCTGTTCGCATGCTGCAACACGATAGATTCGCAAGGTTGTAAGTAAGCAGTTCAATCGCCTCTCAACG
TTACGCATGCGCACTTACGTAATCCTGAGCTCGCTTGAAACCTTTGGCACACACTGAGCAAATAGCGAGGTCATAGCCGCTAGCACACGATGCATTATTC
ACGTCCGCTGCTAATGAGAGTGTTTGGAGTGAGACGTCAGCTTCGCATGCACTTGAAACCTAAGAGACAAATCCAGATCATCACATAGTGCATTAGAGAT
CGTCGCCCACCAACACCGTCAATTGTACCAAGCTGTCGGACTCACATCACACGTGTAGAAGGTTTTTCCCGAGAGACAGGAAAAAAGTCGCTCTGCTGAC
CAATACACGTCAAAGTCGTTCAAGTTGGAGCAGTTGTGGATCACTTCCGACACATTTGCGGCTGGATTTTCCAGAGCAAGGGGCTTGCACGGGTCGTCCT
TTTTCCACTGGCTGGGGCTTAAACAATTGGTCGTTTGTTTCGATGCGGGGGCTAAAAACAGATAATACCCTTCTTCTGTACGAGGAGATACGGTCCCAAG
TTCCTCTCCCATTGTCTCCGTAGCCCGTCGA