Description :
From Genome Similarity Track
Location :
Scaffold_1838:1123- 4675
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1838-snap-gene-0.1Dynein heavy chain
Pytul_var.sporangiiferummaker-pug3_contig_1838-snap-gene-0.2Gene of unknown function

Sequence
3552 bases(100 bases per row)
TCATGTCCAGCACGTCGTACGCGATGAGGTTCTCGAGCGTGAACATGATACCAGGGTACCACGGCTGCCGCAGCGCCTTGAAGATCTTCTCCCAGTGGCG
GTCTTTCATTGAGGGATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTTCCAAGATCGTCGGCATCTTGAGCTTGAACTCGGCTGTACGGTCCTTG
AAGAGTGCCGTGACGTCGTTGCTGAGCTTCTTGTGCATCGCGTATGCGTCCTTGAATGCAACCGCGATCTCCTTGGAGAGATCCTCGACGTTGACTTCGA
CAAACGAGTTCGTCATCGAAGCATGGTATGTTGCATTCCACTTCTCGACTGCGCACCACAGCGTATCGACAGTGCCAAAGAACTCTTGCGTCGCCTGCAG
GTTGAGATACTTGAACGGCGTCTGATTGAACAGTACCTGGTACTCGGTGTACTGCTTTGAGAGCTCGTCGAGTTGCGTCAGACGCTGCTTGGTGCTCTCG
AGCTCGTTTTTCACGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCGAACTGGTCCGGGTCAATGAACAGACCGGTCTGTAGTTGGCTGTTGAG
CTGTAGTACTTGCTCGTCGAGCCGTTGGATGTTCGCATCTAATTGCTGGGTCATATCGGCGATCCGGCTCTGCACGAACGAGTCGACGGCGTCGGTCTCT
TCCTTGTAGTTCTCTTGGACGCTGCGCAGGTCGTCGAGTTGCACCATGTCCTCGGACGAAATGCGCACACCGTAGTTTCCGAGCAGACGATAGAGTTCGT
CGACGACGTTCGTGTTCTTTGAGAGCGCTTTCTGCTTGGCCTTGAGCGACTGCACGCGCTCAACATGACTTGCAAACTCCTTCAGGTGCTGCGGACGCTG
CAGCAACGCCTGGATGCGCTGCTTGTACTCGATCAGTTGGTTCTTGCACTTCGCACGAGCCAAGTCCTTGACGAGCCCTTTCATGGAATCCAGTTTCGCA
GTCGTCATCGGGATCAGCGTCTGCTTGAGCTTGCGACTCTCAACGTGAAGAATGCCGATCGTCTGGCCAGCACGCATTTTCTCGAGCTCTTTCTCCCACG
TGCTGATCTGGAGCATGTCGGTTTTCAGTGTCGCGACTGTGTGCGCGCGCTGAGCGTACTCGTCGAAGTCCCAGACTTTATCGTACTCGTAGATCGGGCG
GACGTTGTCGAAAATCTTGACGTACTCGGCGGCCTCGCCGTAGTCCGTGATGATCTTGGCGACCAAGTCCTTGCGGATTTGCTGGAAGTCGACGCTCGTA
CTGATCGTGAGCCCGACATGTGGCGCATCGGCGATGGTGTTCGCAACGTAGGGCGCAAACGGACGCAGGTAGAGCACACGCGAGACCGAGTTGACGGTGT
TGACGATGTCGTCCGTCATCGCGACGACGATGTGCTGGATCTGCTCGCTCGTTGGCGCGAAGATCGTGCTTTCTTCGCCGAAAAAGATCGTGGTCTCAAA
GAGTCCGGTTTTGCGCGGAACCTTGTTGAGTTCCTGGAGGAATTCGCGGCAGCTCTGGGTCGCCAGGACAACGAAACTCTCGACGGCGACATAGTCGNNN
NNNNNNNNNNNNNNNNNNNNNNTCGGCGATCATTCCGGCTTCCTCGGCCGCACGCTTGAACAGTTTGCGGCGCTGCTGCTGCTCGGACTTCACGGCCACG
ATCGACTTCGTTTTCTCGCCCTGCATGAAACTGCCGCCATGACCGCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGAGAGAAATTCGTCTT
GCGGATCCGACGTCGCGAGCTTCGTCAGGTTTTTCACGTCGACGCACACTTTTTGCACGATCGCCTGCAGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGCTCTCGTACGTCTTTTGCGCGCGCAGATCCAACAACACGACGCTCAGAACCTCGGTGCTCATCACTTTCTTCACGTTCAAAAGTGGCTGGCAG
AAGCTCGCTTTCGCGAAAAACAGCTTCTGCTGCAGCTTTTTGCGCTGTCGACAGTACAATTTGAAGCGCACGTTCGCGCCCCAGCGCGAGAACGCCTTGC
TCACGAGGTAGTACTTGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGAACTCGGACGGATTCCCCGGACTCATGTGCACGAGGCCGCTCGATGACATGGTGAAGTGCTCGCTCGCGATGTCATCCTGGGTCACGACCA
CGAGGTCGTACGGACGAAATGCGATGCCTATGTGTGCGCGGTTCAGGTGCACGAACTTGACCTCGCTGTCCGAGCCATTGCGTGCGAAAAACGCGATTGC
GTCTTCGCCCGTCGTCAAAAACGACGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCGTCGC
GATGGCGTGGACGGATGCTGCGCGTGGTTGCCATAGTCGTCATCATCATGTTCATCATCGTGACCACCTATTGGTGGTGCCTGCGAAGCGAGGGATTCGC
GGAGAAACTTCCGCGGAGACGCTTCACGTTTGGGTCTCTCACTGACGCTCGGGACAGACACGCTCTTANNNNNNNNNNGCAGTCGTAACATTGCTGGTCT
GCGTCGCCGGGTCGTGATGCGCCATGAACAACGTTGGAGACGATCGATCTTGGTTCGTGGCGCTCGTGCGGTGCTGATTGTGGTGANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCATTAGCGGTGATGGGACTGACGCATTTTGCTGTTTGGTGTGGCGGGGA
CTCCGATGCCCGGTGACACTTTTCTTTTTTTCGGGGCTGCTCTGTGTGCCGGGGAAGACAGGAATTTTCTTCGGGGACGTGTACTCACCTGCACTGGTGA
ACGCAAACTTGTGGGCGGCCGCTGAAGCCGACGGTGCTTTGTGTGTAGGCGACTGGAAATGAAGCAGCGACGATGCATGACTGCCACCAGCGCCAGCATG
CATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCTTGTCTCTGTCTTTGATCTTTACGGCGCCATC
ACGCAGCGGCGCCTGCGGCTTGCGTCTCGCGTTAGAAGACTCCATTCAGACGGAAGCACAGCTTTAAGTGCCAGGCTTGAAGAGCTGCCTGGATCGCCGA
CTACAAACGAATGAAGCAAAGCGCCGGCTGCTGCGGGCGCTGAAAGGTCGGG