Description :
From Genome Similarity Track
Location :
Scaffold_2271:1123- 3311
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2271-fgenesh-gene-0.0Protein kinase
Pytar_ATCC12531maker-par_contig_2271-snap-gene-0.3Conserved gene of unknown function

Sequence
2188 bases(100 bases per row)
TGCGCGACCGAACGGTCGTGGTCTTTGACTGGGACGATACGCTCTGCCCGAGCTCGTGGCTCCACGCCGAAGATTTGCTGCCGAAATACCGCGGCCAGCA
CATCCAGCTCACGACCGAACAGCAACAGATTCTCCAGCTCATTGCCGACAACGTGACGCAGCTGCTGCGCAAGGCCGTGTCGTACGGCCCCGTGTTCATT
GTGACGGCCGCCGAGTACGGCTGGGTCGAGCTCTCGTGCGCGCAGTACTTGCCCGGCGTCCAGGCCGTGCTCGAGATGGCCGATGTCCACATTGTGTCGG
CGCGCAGCTGGTACGAGCAGACCTTTGGCGCCGGCGGCGACTCGAGCTTGTGGAAACACGAGGTCATGCAGCTCATTGCGCGCAAGTGCTTTGGCGCCAA
CGCCGACGCCGACGAGAACCTCGAGCATCAGCTCCCGCCGTCCTATTTCAACTTTGTCTCGATCGGCGACTCGTTGGCTGAACGCGACGCGTGCCACGCC
GCCACGGAGCGCGTGCCCTATACATTTGCCAAGACGCTCAAGTTTATCGAGAGCCCGACGACCGAAGAGATTGTCCAGCAGGTCGAACTCACGCACGACT
CGTTTGAGCAAATGTGCGGCTGGTCGAGCAATCTGGATCTGCGGCTCACGCGCGCGCAGCTCGCGGAGCTGCGGTCCGGCCCCAACTAGAGTTTTGCAGC
CCACACGCGGCGCCCCCTCACCATCTCGGAAGCAACGAGCGAGGGGGCGCCATTTTATTCGACATAGTGTCTAGGTAGATTCTCAGCCTCTGTATTTTAT
AGCCACCCCCGAAGGGAGCCGCACTGGTAAGGCCGAGTAGATGGAATACTCGAGCCTTCGGTGCTTTTCACGAAAATGTCAAATGACAATTGAGATAAAA
AGATCACCTTGAGATTTCACACTGGAGTTTCACACTCGACTGGATCGAGACAAAGAAGAGGTCTACTGGAGGTACTGCTCAGTAAAGTTCACGTAGGGGA
ATGGAGAGATTATTAGGGAGTCCTACGCCCTGGGTCCATCGTGTTGTGGAGATGGAATGTTGTGCTGGTCTCTTACGGGTCCGACTGTCTGCTGGGCGTC
ACACTGGGGCTTCGTGATCTCGTGTCGGGCTTGAGGATCATAAAGTGGAGCTCGCTCGCGGACGTCGTCGAGTGGTTTTTCAAATAGTAGGCGTTCTGCG
CCGGAATGTAAAACTCGTCGCCGGGCTTGAGAAGGAACCGCGTGGCGTTTTTCGGGTCAAAGATGCCGTCTTCGGCCGGCCCGAAGGCGACTTCGAGAGC
CTGCGGCTGGCCCGCCGTCACGAAGAAGACCTGGACGGCATCGCCCACACTTTCGGCTTCCTTGGCAGCACCAGGCGGCAGCCCGAGGCTTCCGGAGATC
CACCGCGAAAAGGGCGTCGGGTTCCGCAAGTTGAAGCTCTGGCCAGCCGTACCGGGTGGCAGATCGTCGACCGCAGGCAGTTCCCGGTGCTCAACTTCTT
CGGAGCGACACAAGATGTTCATCGTGTTCATGGTGTTGGCCGAAATGTCCCAGAGATCGGCCCATTCACCATCTGTGATCTTCAAGCCTTTTGGCAGCAT
TTCACGCGGCAGCGGCTTCTCGTTCCGCGGACTGCGTGTGGTTTTTTTGACGCCGGGGCGGCTTTTCTTCATCGGAGTTGTCGTGCCGACCCGCTCAATA
GCAGCAACTGTGGGGATCACGAGCCCCACGCCCGACTGGCGTCGCTCGTACACATAGTGCTCGCCCTTGTACCACGCCAGCGGCTTGTACCGCTTGCGGT
TGGAGCGACGCAGTTCCCCACCGTCCGATCGCCGTGCGTCCTTGAGAATCTCATCGGCAAACGACAAGTCCCCTTCGCGACCGTTTCGAACCCTGCTGAG
GTTGATGCTCTTGTCCAGATCGTCATCGCTCTCACTCGCGATGCCGCTCGTGGCGAGGAACGATCCGTCATCATTGTCGGTTTGTTCTTCTTCAAATGAG
ACCTCACTTGCTGGCGTCGACTTGTAAGTGTACTTTCTTGCCTTGGACTTGGGCGCCGACGACTCCTTGGCTTTGGTCGCCGCGGGCTTGGTCTTCTTGG
CACGCTTGGTAATGTTCGTGTCGCCGTCCCACGCATCCGCTGCACTCTTCTTCTTCGGCTTGAAAAGCTGCACCTGAATGTTCGGTGA