Description :
From Genome Similarity Track
Location :
Scaffold_114:112278- 114624
Transcript NameFunction/comments
g14420.t1hypothetical protein

Sequence
2346 bases(100 bases per row)
CTTTCAAAGATGCTTTTGGCGTATTAGGACCCCCGATGGTTTCGGTGGCTCTGATCTGTATTTCATGGACTGTATGGCTCATCATACTGACTTTGGCCCC
AAACAAGACCGCTAACTACCTGATGAACACTGGTGACTATGACGACGGCCAGTTCTGGCTCATTCCAGAAGAGCTAACGCGACTGCAGATTTTTAGCGTG
ATCGGACTGCTGATTGTAGTCACGTTATACGTCTGTGTTTTACTCAAGATGTTGATTTGGCGTGCGCACAATCATGTTGAAGGCACACTTCTCGATCGGA
TACTACAGCAATGCGCACCTGACGAAGTTGGTGCTCCAGCAGAATTGGAGTTTTCTCACAGGGTTCGCAGATTGATCTGGGAGCTCTACATGTTCTTGAA
AGAACTCACTGGGTTCCGGGGCAAGCACCGAAAACTCTGGGTGCGTTCGTCCGATACACTTTGGTCATTTACTGACTAGACTAACACAACTATTTTTGCT
ACGAGTTAGAATTTGTGCCTTAAGGGGTTTGACTTGATGATGCAGACGTTCATGCTTGTAGGACTACTCGAAGCTGGGACTCCGATCCCCCTCACGCTCG
GCTTTGCAATTTTTATCGCTTTGAATTCTGCTTCGTGTGCGATAGAAATTGTCGGCCGCAGACATTCTGCCTTTGCAGAGATCATCATCGACTCGCTTTT
CGATCTCAGCGCGACTGTGTTGTTCCCTATCCTGGTGCTCGCGTACTGTGCGAAGAAATTTCACTTTGATCGCGCTGTCTTCATGCTTTACATGGAGCTG
ATGCCGGCCGGAAGTTTTGAAAGGCGTGCAAGAATGTTCGCCAGTCCTACCGATATCGAACTGTTCCGGGTTTCATTTGACTCACTGCGCATTCGCACCG
TGTCAGATCTGTTCTTGAGAATCGGCATGAATTTAGGTTTTTCTTATCGCTTCAAGAGAGTAGTTGAGGTGCTCATTCAGATGCAAACACAACGTCTGTG
GGACCGACAAAAGAAAACGAAGAAATCTGTGCAGCAATCCAGCTTACTGACCTTCCCAAAGTCAGTAAACCGCTTACAAAAATGTCAGCGAACCGTGCCA
AGGCCACTAGCCCTTTTGTTTGTGGCGTATAGCATTGGTATCTTGATCGTTACTCACCAATCTATAGCAGCGTCACAAAAAGTATGTTCGGCATACCCCG
AGTGTGTTGTTTTTGCGTATCGTTGGAGATATTCCGACTTCTGTCCGTGTCGAGCTCTCATTGATGGCAACCGAGCGCCAAAGTCCTATTACGAGTGGAC
CCACCCTAAAGATGCCACAGATGCGGTGAAAGCGCTTGCAGCGGAGGGTACGTTAGAAGTTCTCCAGCTAATAAATCGGCAACTTGCAGTATTACCAAAC
GAATTACGCGGTTGTCGCGGCCTCAACTTCATGTACGTTGCTGCTCCTGGTAATCCACGCGTGAAACTTGCACTGATGAAGACGTAACTTTTTACCTGGT
GAACAGAGCTTTGATCAATTGCGCTATTGAGGAGCTACCTCCATGGGCGAAGGAGTTTGACAAGCTGCAATACCTGTAATACTCAGTTGGAATGCAAGTG
GCTACTGTTTATTGACTTTTGTATGTTCTGTTGCATTCGTTCCTTAGCCAAATCGAGGGGAAGGTTGGAAGTACGAATATTGGTGAATTGGACGAGGATT
TTTTCAGTAAGATGCCCGAGCTTCGATATCTTCAGTTTGGGCTGCATCAACGGATGGCTCGGCTACCGTCATTTGATGGAGCACCAAATTTGGGGGTTCT
GGTGATCGCTCGAATGTCGAATCTCACAGAGCTGCCTTCTTTAGCTCATCTCACCCGCCTTGAAAGGATTGAATTGAGTGTGATGAAGTATCTGGTCACT
ATTCCCGATCTTCAAAACGTTGGTCCGCTAGTTCACTTTGCGATTTATCAGGGGGCATATCTTTGCTGTAATGGATTTCTCGGGGTGTGCGATCTGTCGA
ACCCATTTTGTAAGAGTACCAAGTGTCTTGGAGATCCTACTTTAAAAGCTTCCCTAGCTACACAACAAGTATTTCACAAGTTTTCTGGTGATGTCTGTCA
ACCATATTCAGCAGTCTCACAAACACCAACTACGAAAACTATCCAAATGTGCGATAACACCCCGTTCCGACAATGCAGTCTACCTGGCCTTGAACCGAAT
ACCACCGTTGTGGGAATGTGCTACAACCACCGCATGCAGGTTCTCGCATGTAATCCAGACCCTGCGAAAATTCGTGTTCGGCGTAGACAAATTGAGCTTG
GGGTGGGCGCTCCGTGCGATCCGGCGGAAGAAGCGTGGCTGGGCTG