Description :
From Genome Similarity Track
Location :
Scaffold_4:112261- 114406
Sequence
2145 bases(100 bases per row)
GAATTTAAGGACGTATTCCCTGACGACGTCCCCTGCCGGCTGCCCGTCGACAAGGGCATACGCCACGAAATTGACCTCGTGCCCGGCACGAAGTATTGCA
TTATTCGCCAATGGCCGCTTCCACGTGATCAAGTCGAAGCGATCGACGCCTTCTTTGCACTCGTAAAGCCACCGGCCATGTCCGCGAAAGCACGTCTCCA
CACAGCAGTCCGACAATCTGAGTGAAGAAACCCAACGGCAAATGGCGGAACGTTCACGCCTTTAACAAGCTCAACGCCGCCACCATACCGGCGCAAACAC
CGATCCCCCGCAAAGATGTGATTATCGACGGCATGGGTCGATCCACCATACTCTCGACCATCGACCTGCGCGATGGATTCTATCAATTCCTCATGCGCCT
TTGTGACGTGCCAAAGACCGCCGTCTCGACACCAAGTGCAAAGCTTTGGGAATGGCTCGTAATGCCCCAAGGCCTATCCAATGCTCCTGCGACGTTCAAT
CGCATGGTCACGGCCAAGTTCCGCCCTTTCCGCGACTTTGCCCCATCCTATTTCGATGATATCTACATCCACAGTCGCGGCTCTGAAACCGAAACCGACG
TCGAAGTTCACCGTCGGCATCTTCGTGCCGTTCTCACCGTCCTTCGCGAGAATGGCTTGTACGCCAACCTCTCCAAATGTCAGTTTGGGGTCGACGAAAT
CCCTGTTCTTGGCGATCTCGTCGGCATTCGTGGTTGTCGGGATCAGCCCGACAAAGTCAAGACTATCATCGACTGGCCCGTTCCCTCCTCGGTTACCGAC
CTTCGTCGGTGGCGTGGCTACTTACCTCCACAAGTATTCTCGTGGTTTTGCTGATATCGCGCAACCCCTCTTTCGGTTGCTAGTCAGGAATGCCCCATGG
GTTTGGTCGAGCGACTGTCAATCCGCCTTTGACGCCCACAAATCTAGTATCAAGAGCGCCCCAATTTTGGCGCTCTCTGACTTCTCGATGCCGTTCTGCG
TCGTGTGTGACGCCTCCCAATTTGCCATCGGTTGTTACTTGATGCAACCTGACGCTGATGGTCGCCAGCTCCATGCCGCCGAGTGCTCGTATCCCGTTCA
TGACCTCGAGCTCCTTTCGATCAAATACGTCCTCACCAAGTTCCGCGTCTACCTCATCGGCGCGTACCTCTTCGTCGTGTACACCGACCACGCGTCGTTG
CGAACTGCCGTCAACACGCCACACATGTCAGCCCCCATGGCTCGCTGGCTTTCCTTCTTCGCCGAACACAATTGCTCGGTTCAATACAAACCGGGCAAGG
ACAATGTTTTGGCTGACGCGCTCTCTCGGCGTCCAGATTACTCCTCGTTTGTGGGCCTTGCCTCGATCGGATTCCTCCACTCCGATCTCCATGACCGCAT
CCGAGCTGCCTACTCCATCGGCGCGAGTTGCTCGGCCGTGTTCAGTGCCCTTACCACTCTCGAGCCGCTCAAGCCTCGGCGATCACAATCCTTACTCCAT
CGTTACTCTGTTCGCGATGGCCTACTCTACTTCTAGCCCGCCCAGGACACGCCTCCGCGCATCGTTGTCCCTGGGGATTCTGCGATTCGTGCCTCCCTTC
TGCGCGCGTATCATGATTCACCCAGTGGTGGCCATTTCGGCCGCGACAAAATGTTCGCTGCGTTGTCCCATTCGTATTGGTGGTCTCGTCAATACAAAGC
TGTCGCCCGCTACGTCGCTCGTTGCGACGCTTGTCAATGCACCAAGGTCGCGTCTTCCTCTCAGGCGCCACTACAGCCTTTACCGATTCCCGATGAGCTC
TGGTCATCGGTCAGCATGGACTTCATGTTTGGTCTCCCGCGTGACGCTCGTGGTCACACAGGTATCATGGTTTGCGTCGACAGGGCGTCCAAGTACATCG
TGACCGTCCCAGTCAAAGAATCCATCAGCGGCGTAGATGCCGCTCGCCTTTCCTTCGATCATGTCTTCTGTCGCATTGGATTTCCGCGGTTCATCGCCTC
CGACCGCGATCCCCGTTTCACCTACCACTTTTGGTCGGTTCTGTTCGCGCTCTGTGGCACCGACCTTGCCATGTCTACTACCGACCACCCCGAGTCGGAT
GGTCAGACCGAGCGTGCCAACCGCGCGCTTGAGGATATTTTTCGC