Description :
From Genome Similarity Track
Location :
Scaffold_70:11226- 18182
Transcript NameFunction/comments
Phyci_314897Hypothetical protein
Phyci_29750Hypothetical protein

Sequence
6956 bases(100 bases per row)
ATCCTCTTCGCCACTGCGGAAGAACGCAACGAGGTCGGCAAAGAGGTCAAAGCTCACCTTAGAACAGAAAGCCCAGTTAGCTATTGCCCGATGCCAACGA
CCCCGTTATGTACACAGCAGGCTAGCTCGTACATTGAACGGATAGGGAACTTTGAACCGCACGAGCGCCTCTGTAACTTCGTTTGCAGTCACACCGATGC
CTAAAACGTTGACTACGCCGAGCCGCGCTACACAACAAACACGGTTGCACAAGCAGGTGAGCAGCCCTCAGCCATGAAGCAGCACTCGACAGCGCACATA
CTTTGCGCGATGGACAGCAATCCTCTCCCTTCTGTGTCGGCCTGCGAAAATGCCGACCAAAGCAGTTCCATAGGGTCATCCACCTCCACAGTCTCGCCGA
CGTCGTCGTCGCTCATGTCTGAGCCAAACTGCCCGAATTCGTCATCCGACTCGTCTTCATCTTCACCCTCGCCGCCCAATGCCTCTTCCCCCTCTTGAAC
CGTTTCCATTCGCAAGACAGGATTCAAATCCTGTCCATTCTTGGCTTTCATCTCGCGTGCCTTCTGCCGAGCCATTTTCTTCCGCGCTCGAGTCGCCTTG
TAAGCAGCTAAAACTTTCTTCTGCATCGCTAGTTCTTGTGCGATCACCTCGCGTTGCCGGGGATCAACAACCTTGTAGCATTCCTTGTCCGCCTCACGCT
CCTTTTGCCATTGTTCCCACCTGGCCCAGCCCGCGTGCATCTCAGTCAGCTCTGCTGCAGATAGCGGCTGAATTTGTTGCACACGCCTCACCGTTGTAAA
ATGCTGCTGTGGAGATGTGTCCTTCATCTCAGCGAAGTAATTCGGAAGATACTTGCCTACAGTCGCTACTGGTCGTTGAAGCTCCATCATTTCTTCGTGG
AGTTTCGCATCATTATAAAGGGGCTGTGGATGTCGCGGGCCACTCAATTGTCGTAGAAAGACATGGCTTCGCGTCGTCGATGACCCGCTGTCCACTATAT
CGCCCACTTGATTTTCTGATGCTGCGCCCTCAATATACTCCGTGATGTCTTGCGGTCTTAAAATCTCAACGCCCGTTCCATCTCCATTGAGGACGAACAT
GTGGGGAGGAATTGGCTCATTAATGACAGCTTTCGCCGGAATAGTATCCACTTCGTATCGAGCGGCTTCTGTGTCACTCACTACGCCTGCAAGGTCAACA
GCAATAGTAGGACCTTCTTCCTCATCTGTTTCATTAAAGTCCACGTAAAATTGGTTTTGCTCACCGTCACAGAGCTGGAAATGCCCTCGGTGGAAGTCGA
AGTAATAGACACCGTTGTGGCTCGTCACATCCCTATCGTCGTCATCTTTGGCGTCTGCGCCGTCTGGATCAACCACTGGCCCCGAGCTGTATTCCACTCT
TCCACTGTCCTTTGCTACGATAACTTGCCCAGTAGGTTTTCGAGTTACGACTCGGCCATTCACTTGCGCTGTAACTTTTGTGTTATAACTGATCTCGACG
TGCGTTCCGTCGTAAACTTCGACAACGCTGCGCACGCGGAGGCCACCCTTCGTGACTGCAACACGTTCCCCTGCTGCGTGGTGCTGAGCCGTCACGTTTA
CTTCCACATCAATGCAAACATCGGCAAAGCCCCGCTTTGTTACAAGTACGTGCGTGTTACCAGCATTCAGATACATCCTTGTGCCATCCACATGATACGT
CACACGGGCACCGCTCGTCAAGGTCACGATTATTACGCCGTTCGGACGTCGTTCGACTAACGCGTTCGTCTCAGGATCCACTGTAAGCGTCGTAGCTAGT
GGTGGTGACATTTCAGTGTTGTTACTGGGACGTTTTCGAGATTTGTGTCGGTGCTTTTTGCAATCTTGTACCACGCGAATGATACCGTTTGCTAGCATGA
CTTCTTTTCGTCCACACTGAAGCACCCGTAGTACACTCCCCTTCCCGTAAATTACACGATAGGCTTCGCTTTCCACGCCGTGTTGCGTTTCAGTCGTTGC
TGCTGCGTTGGGGACACTGTTGGTTTTAGCGAGAGAGACGTTCTGTGTAATTTGGGAATACCGCTGAATGATGGAGCCGTCAGAGCAAGCAGACACGATC
AAACCAGTAGGAAATGAGTTCGTCGCTGCGACAGTAGAAAACTTGTCGGGCTTTTTTGGTAGCCTCCTTTTTCCCTCGGTAATGTGCAGTATAGATTCAT
CTTGGAATGATGCGACGAAATGAATATTATCCGATGAAGGTGAAGATTCCCCGGGATTTTGTTCTGTGAGCACCCTGCGGTTTCCCCCATTTGTATGCAT
ATCCGAGCGTAACCCAAACGTTTCACTGACAACAGTATGCATGAAGTGATTAGCGATAACCTAAAGCAACTTAAAGGGACACATGCACGCACCCGTGGAG
GTAAACGGTGAGCCATATTAATCCTCGAGGGGTTTGGCACAGTCTCACCACGCTGTGGTCGGCAGGATACATTGACCAACTTCGCGTCGCCACCATCTCG
AGCTGTCCAGCGGACAATGGTACACATGCTGCTGCTGCAGCTTCAGTACGTGGAGTGAGGTATTCATTGGAAACGAGTTTCTCATTTTTCCAATCTTTGA
ACGCTGGTCGATGGCGCACGTGATCCCGAGCGACCCATGATGTCATTTGCATTCGCCCAGGTGCAGTTTTTGGGAGACATGCCAGCAAGAGTGAGTCCGT
GGGTGCATAGTAACTTGAATATATGTCCGACGTATTTTGCTGGATAACCGATACAATTCGTTGCGGAAGAATGGCACGTGACAAATATTCCATAAATGCA
CGAGACTGCAATTTCCCCCTCCACGAGTTTCCCAATACCTCTTCGATTTGCAAAAGTTGTCGTGTTAAATGAACCATCCAGCAGCTGAAGCGACCTGACT
CGTAGAAAGTTGCAAGCTCCGTGTTGCGTACACAACGCCCCGGCTCAGGCAGCTGTGGCGTCCGAGGCATAGCCTTCCGCCCTTGGTTGCCTACACCCGG
AAGATCGCTTCGTCTCCATATAGCCCTTTCAATATCATCAAGGCGACGCCCGATGGCAAGGAAGCATGGGTCTCCCTCCGCCTGAAGTGTTTCGTGATAT
AGGCGAGCGCTGGCAAGTCGACAACCAACCAAGTCACCATACTCGATGAACTCCTCGAAGTCTGACGAATCAGTTTGGTCCCGGCTGCAAGAAGATTTTG
ACGAATGCATCGGAGGTGACGAGGCAGCAGCTGCCACAGCTTCGATGGCAGCATATAGCACTGTACTGACAGCAATACTGCCGGGAAACACGCCATCCAG
GATAGATTCATACTTTTTGTAGAGAAGAACACCACTGTCATCATTAATTGAAGTTGGAATTGCACAAAATTTTGTATATCCAACCCAGGTTTTGAACGCA
AATTTCTGAGCTGCCATCGTCTCCACAGTGCTGATAACCTCTCTCTCAAGCTCTTCCGGTGGCTTGACGCCCGCCGCTTCCACACTGCAGCTTACATTCG
TGAAAGTAAAGTCACTCCACTCGATCCCACCCACTTGAGCAGACTCATAGAACACCTTCACGGCGGCATTTGCTGTCTGAAACACGGTTGTCTCCATAAC
TGACACTCTCGAGCCTACTTCTTCCGCTTTTATTATGGACCCCACTCGGCTCCGTGGCGCACTTGTCGAGCTGCTTCGGTTTCGACCGCGTGCTGCAGAA
GGGTCTGCCAGCAGCACGACCCCGTCAATAAGCGGCAGGAGCGGCAACTTTTCCGGGCCGTCGGTCGCTTGCGATGCACAACCTACTTCCCCCAGTCTTA
GCAGTGCAGTTATCTCGGCCAGAGACGTAGGGTAGTCCACCAGCAGGTACACCCGCGTTGGCGGGTGAGCAAGATCCTCCTCGCTTTCCTCAGAGCTGTG
AATCTCCCTGTCCGCAACAAGAGGCTGCAGCGGTTCGCCTGCTCCTCCTCCTCCTTCGGCCGCACTCGGGTCTGTCTGGTGGTAGGCGAGGAACTCGCGC
TTGTCGCGGCCCACGAGCCGCTGGAAGGCCAGCGCCAGCAGCGCCGGCGTCACGGCGACCGCCTTCACGTCCTCCCTCTCCTCCGCCGCGTCTGCGTCTC
CCGCTGCATCCCCGTCGGCGGCTTCCTGCAGCGCCTTCTTCTCCTCGCGCCGCTTGGTCTCCGCCTCCTCGGCGTGCGTCGCGCGCACCAGCTCCTCCAG
CTGCGGCCGCCCCACGACGCGGTACGAGCAGCTCCGTTGCCAGCTCGAGAGCGCCGCGTCCGCGCGCAGCCTGGCCAGCAGCTCCCTCTTGGCGGCCAGC
TCCTCGTCCGCCGTGCCGCTGGCCACCGCCACCGCGTGGAAGCTCCAGCTGCCCATGCGTTGGTTGAAGTGCCAATGTCCCCTGTCCCTCTGTCCCGCTA
GCAGCGTCCCACATTCACTCCTTCCCAATACAAAATACAAGTGTCAGGTTGAACTTGCGACACCTCGGACTCGGACAGCGGCCGATCGCGAGCCACTCTT
GATCCTTCAGCGGCCATGCGACTCGCGCAACTGCTGCTCGCCTCGTGCgcggtggcgacggcgacagcgacggcgacagcgacagcgacggcTCCGTGCG
ACGAGCGGAGGCTGGAGCGAGACGCTGTGGTGGTGCTGGCGGCGCACGTGGACGTGGAGCTGGGCGGTGTCGGGGCCGGCAAGCGCGACGTCGTGGGCTT
CCAGTACCTGGTACTGATCACACCAGGCCAGACCTCGCAGCCACTGCAGCCCCAAATGCTAACGCGCCTCCTATGCGTGAACTTTAATAGAAACCGGCGG
ACGCTCTGCTGGCAGCGCAAGCTCTCGCGCACGAGGACTTCGACCAGGCCGCAGCGCAGGTCCAGCGCATCCTGCAGTACCAAAAGCCCGACGGACTGCT
GCCACACTTGGTCTACGGCCCGTCCGTGCCGTCGGACTGGCACTGGATACCCAGCAACCGCACCTTCCACCCAGGCCCGGCATTCTGGCAGACTGCAGCG
CTGGCGGACCAGCAACAGGAAGAGCAGGAGGCGCCGTCCTCGCCGCTGAACACCTCGACGATCTCAGCTCCGCCCGTGGCTGCTGATGTGGCGTGGGAGA
TCTTCCGCTTGGCGCCGTACGACTCTGTGCTGGGGGTCAGGACGACTGCAGTGCAGTTCTTGTGTCGCGTCTACGAGCCGCTGAAGAAGTTGCAAAAGCA
CCTGTTCTTTACACGCCGCGGCCCCGCCCCAAGCAGCTTGCTGGCTGCTCGTGTAAGTGCATGCTTATCCCTAAAGCCGCGGAATGGGCGATCTCTGACG
CCTCCTCATGCTTGACTTTTGCGATACAGCATCCTTGGGAGACGTTTTCGTCGCTATCACCGCACTGGAAAGCCTTTCTTGCCGAGCTGAAGAATGCACC
TGACTATGAGACGGTCATTAGCTCAATCCCCAAGGAAGCCCGTACACGCTTTGCAGACGGAGCACGCAGTATATTATTAGCGGAAGACACGGTGGAAAAT
TTGTACGAGCCAATGATATATCTTGCAGCGCAGCAGCGCAGTGGAGGAAGCAGCGATATCTACACTCGAGAATCAACTGTATTTGACTCCATCACTGAGG
CCGGCAATAGTGCGGCTGCTCAATTCGGAGTGGAGGATGTGGAGTTCAATGCACTTGCGCTGCGATCTTCGTTGGGCCTAGTCAATATTGGCCGGGTACT
CCTGGAGCACTCGTCCGTATGTACGGGGTTTGCACTTACTCAAAAGGAGCTTTTGCATGATATGGAGGAGCTGCAGTCAATGGCCAAAGGGCTAGAGGGA
GCCCTCATCGGAAACAACAACACACAAGGTCTCTGGAACGCCTCCAGTAATTTTTTCGCTGACTCGAGCAGAGTGTCAAAAACCTCAGTTCACTCCTTGC
GGGGATTTCTACCTGGTTATGCTGCGGAGCTGGACGACGACAAAAAGATGCTCTCGATGAAGCATTTTCTGTCGGAGCCGGGTTCGTTCTCTTTCTTTTG
CACTCAGTTTCCGGCTTCATTTTTTGCCTGCTCTGGGGGCGATTCGTTGGGTGGCCATAGCACGTGGATTCTCTACAACTATTTCTTGCAGCGAGGGTTT
GCTCGGGTAAGTCTCCTCTTTGCGGTTCGCGCAGAATTACTTACTCTACGCTAATAACTTGTGGCTGCTAGAACAAGTTCCCAGGTTTGGCCGACTACGT
TCGCAACAAAACAAGAGACTTGGTATGTGAGGCGACAGTGCCTGCTCGAACGTCGTACACTTGGTTTCCATTCTCGCTGGCAACAGTAGAGCCCACGCCT
GCAGCTTTAGCGCTAGCTTATGATTCGCGCAGCGCGACCCCGGTCGACATCTTTGACGACAGTTATTTGGGGTCTTCGCTGGCAGCTGCCGTCTTGCTCA
ATGTTTTGCTGCCAGCAGGTATGGTAACTAAAATCAAGCTGGACCATGGAATTCCCATTGCTAACGCTTTGTTGATGCTATGTTATCAACAGTGACCCCA
CCACCTAGCCCAGACACACCGCCCATTGACCATCGTATTCTCTCTGTAATCATGTGCGTTGAGTTAGTTGTTGCATTCGGCGTCGCCATGAGCTGTTTCC
TGTTCTCGGTGTATTTTGTGGCGAATCGACCGCGAGAAACAAGACTATCACCAGCATCCGCAGACCGCCGACGATCTTCTGCTGGAACTGGAGGGAAAAA
GCCCCGTGACAAGTTTGAGCGCGACATGGAAGATCGTAGCGCCAGCGGCTCATCGTGGGCAGACAGATACTCGGAGTCTTCGTTCAGTGACTACTCGCCA
CCCTCCGGGCAATCACCTTATGAGTTGGAGGAGTCGTTAATTTCGGAGGAGGACGAGCACTACGGTTCTTTTGATGAAGCCAAGCAGGAGGAAAGTCCAT
CCAATTCGGCATGGAAAGCTGCGAAAAGCGCTCTTGCTGCCATTAGTCCCTGGTGA