Description :
From Genome Similarity Track
Location :
Scaffold_789:11226- 12825
Sequence
1599 bases(100 bases per row)
GGTGGAAGAATGCAATAGCTCGTTGAAAATGACGTCTTCGGCAAGGGTTGACACGCCAAGCACAACAGGGGGATCGTGGTCGCGATCGGGAATAGCGGCG
GGATCAGCGATAACAGGGGTTCCAGCAGGGTTAAAAAAAGCATGTTCTAACATTTTCGTAAAAACATTTTGACTGGGTTTATCTTTTTACCAGAACAGAC
TCGTGTTCTTACGTGTTTTTACGGGAGGTATTAGATGTGGTGTGCTTCCACATCGTGGGCAGCCGTGTCCGTAAAATAtggctgctgtgctgcagaAAAG
AGCTACTGCCTTTCCCGGAGACATTGCTGACCTTGTGCATTCGCGTCCCTCACCCTGAGCAGATCGGCATTCGCTGAACGAGTTACGGCGAAGCACCTGG
CATTGGCGCCGCcggcactgctgctcgatgtGTTGATGGTGCCGAAGATGCGGAAACCATGCCCTCACAACCTCCCTTGTGACCGTGTCGGCGCCCGCAA
TTGCTGCTTCGGTATCAAGGACAGACTCGGAGGTCGTGCTCTCGTCCATCACGATGCCAACCGAAAACGACGCCGACCGCCGATGCGTCCAACCATATAG
TTGTCAGTTAGTACAGCGCCGTCCGGTACGTTGGGCTGAGcgcaaagctgcagcaacagagATCGCGGGGAGTTTTGAAGTCGCGCTTCACTTCCACCCC
ACAAAAATATCGGCTTAATGTGGCGCCAGAAGGCCACGACGCCTCCCAGGATGTTTGACTTCAGTTATGATTTTACCAGGATAACATGTCCACCATTGAA
ACGCAGTTCAAGTAGCTACAGGAGAGCGGTTGTACATCAACTGTGATGGACCAACAGTAATTTTCAATACTGATATATTGAAGTTGTGGACTCTGGGGAC
ATTTCGTTAACGACGACTGTATCGAAGGACTTGATAAGTCTGTTAGTTTTGGTGAAAGTGTTGGAAAGAAGGTCGCTACGCATAGGCGCACGACCTTGTT
TTTCTTcagtcgctggcggcgctaCGACGCAGCAAACCTTGCTATCTTCCAGCTGGGAATTCCAAAAGAAAACAGGTCCAAAATACCCCTCAGTATCGTA
AGCGCAGCTTAGTGAACTGCATTCCGGATCACATGGTTGGAATCATAAGAATGGATTGAAACTTGCAACTCAGTTTCACATTTATTGTTATTGTGGAGCG
AGTACATTGATTGTTTTGATATCGTCCTGACAGCAACGCATTAAAGGGTGCACACGCACTCACAGCGTGCAAGCACGACATAGCCATCAATTCACGGCGA
AAACAGTAACTCGCTCACCTCCTGGCTACCATCGAAGAGTTCACCGAGGGTGGTTTTGCGCCCCCGCAGCCCTCGAAGTTTTGATTCTTGTGGATAATTG
GGATCATTTTCACTGGGAAGACTAACGCTGCGATCGGGCTCTGGGATTCGgccgtcgtcggagtcgtaGTCATAACCAGCTGGAACACTACGTTCAGGTA
TGTGTGCATTACCACGGGCAATGGCGTCAAGTGtatcttcttcgtcgctgtaAAGATCGACCAACTGAGAGAGCTCAGCTGGCATCACCCCCATCACTA