Description :
From Genome Similarity Track
Location :
Scaffold_6:112237- 114720
Sequence
2483 bases(100 bases per row)
ACCAGATCTGCATACACAAGATCGCCTTCGTATGCGCTGAGGGTACCAGAAAATAAGATTTTTAGTGAAAGAGTAAAAGAATTATTTTTTTGGTCAAGCC
TTACCTGCTACAACAAGTGTAGAAGCTGAATGCCACATCCGCTCAATCATTATTGGTGCTTCTGGTGGCGTAATCATGCGAGTAGGGGTTTCTCGGACGT
AGTGGCAACGAAATTGAAACGATTGATTACCGCACGCATCAACATTGAAGTAGTTATGTCTCAGTATGTTGTGACGTCTTGAAGTATCGTCTTGGCGGAA
ACTTTAAGCTATGTGATTGCTCCAAACAGATCTGAACGTTTGGTGGAATCGTAAAACCTCTCTACGATGCCTTTAAGCAATGAATAAATACCAAAGAAAG
GATGTCTTCGCAAAGATTGAGGTCGCGAGTCCCTAGTAGGCTAAAGATATCCATCGGATCGTTGAAGGCAACCATAACATTTTAACAATCATCTCCAAGA
GCCCTAAATTTTGCCTTGGCAGAAAGGTCGAATATTGTTAATAAAGTATGAATTTGACAATGTATGGATATAAAAAAGTTAGACAGCCGCTATGGCCACA
GTCACTAATACTGCGACCACAGACATCAATACTATGGCCACAGACAATTGACATAGCCAATTATAGCTAAAAAATTCAACTGTAACTACGCACTCCAGCC
AATAAAATCATTTGTTTACTTGTACACACGAGCTTCTGCTTCTTATGCGTTTCATGTTAATTTTGTTCTAGCGTCATTACGGTTTCTGAGTGCCACTGAT
ATCTATGTATAGGAAAATACTTTACCGATGTGGATGTTGGGACGGTGGTTACTGTTGATCAGGAAGCACCGCACTTTGGCATTTTCCTCTTCCACGTATT
CAATTTGAGAAGGTCTCGTCGTGCTGAAGTTTCGGTGCTCGTTCCACTTGGTCTTCCTCTCATTCAAGCAGCTTTCGATTCTTCAAGGACTTGTGGTGTT
TGCTAGTATAGATGTCTTAGTACCTATTGGAATGTCAAATAGAAAATAACCACCACCAAGAAATACCTGCGATAACTCCGTCAGTTCCTCCACGACTTCA
TCTTTCTGGTGTTGAGACGAATTGCTAAATTGTCTCGTAATGTTTCGAAAGGGACTGGTGAAGTATCATCTGGGTGGTCTGCAACAAATGGTCGTACTGA
AGGGAGATGATGAAGGTGCCATTGAACATCGAAATTGTTTAATTCCAGTATCCTCTCTCTGCGATGATCAGCTTGATTTGTGCTCGCAAGGTATTCTTCA
TATGGTAGTGAAAGCGGAAATGCATGGCTTGGCGTTGATTGCCATGGGACGTCGAGCATTTTGCAGCTGTCATCGCGAAACTTTAGTGGTTGAAAATATT
ACGTAGGAAGAAGAGACAACTAAAATCTCACCTATTCAAATACTTTCTGATGGGCGTAACAAGAGATTTTTCCGGTGAATATTTTAAAACAAAAGTCACC
ACGCGGGGTCGGCTGAATGAATCACAAGATTTGCATTTGCTGCTCCGCCAGTTCTGTGGTGAATTCGGCCTGAAAGGTTTCGATTGACTGAACAATCCGT
TTGTAGCACCCAAACAGATTTTCCATGCTACTTGCAATGAACTCTTTCACGACATTGTGGGAACCTTCTCCGCGTGAGGTAACTGTGTGACTGAAGTGCA
AAATCGAATTTGTCCATACCCGACCAAATTTCTCCTTGGGGATCGATCCACGTCTTACTCTACATATTCCATGTGGCGTTCGGTCCATATCAGTTGAAAA
ACTTCACACTTTTCTGCGAATCCTCAATCTTGTTCGAATAACCACCTGTACAATACGGAATAAATTAGAACATGAATGAACATGAATAAACATTATCGAT
CTCAAAAAACGAAAGGCACCTTACCAATCTCCAATCCTTTTCGAACGCTTTCCACTCCTCAACATCTCTCCCAGTAAAATGGGGCTTGCATTTGGCGACG
ATGTTCTTCTGAGTGTTCCGAATGCAAAACAGGATGGTTGCTAAAGGAAATACAATCCGCAGAGCTTTTATAAGAGCCAGATCTCTTAAGATAACGAAGA
CTATGGGCAAATGTTCGGCATGAAATAATTGACGTAAAATGTTGATAGCGGTAACGTACGAGTCGGCATCCTCGTTCTTCATGAAAACGGAAGCCACCGA
GAACGTCGAATTTAGCATTGTATTTACTACAACGTGGAAAAAAGTTAGTCTCGTCTTGCTTGTATTAATCGTGCAATCCAGCCGTAAAACGTTGCAGTTT
TTACGTAAGAGTGCCACGTTCTTTGGATGAGCAAAGAAAAAATTCGTGATGCGCCCATCGGTATTTTTCTCGATATTAATTTCGAATCCAATTTCCGTGA
AGTTTTAAAACAGCAAATCGATGGGAGTCCGTCCATCGGGTTTAATAATAGCGTTCTTTTGCTTCAAGTTTCAAAGCTTTTGC