Description :
From Genome Similarity Track
Location :
Scaffold_4:112218- 114398
Sequence
2180 bases(100 bases per row)
TGGGCTTCCCTCCGCTCGAACCCGTTTTTTCGGCCTCCTTGACGAATTTAAGGACGTATTCCCTGACGACGTCCCCTGCCGGCTGCCCGTCGACAAGGGC
ATACGCCACGAAATTGACCTCGTGCCCGGCACGAAGTATTGCATTATTCGCCAATGGCCGCTTCCACGTGATCAAGTCGAAGCGATCGACGCCTTCTTTG
CACTCGTAAAGCCACCGGCCATGTCCGCGAAAGCACGTCTCCACACAGCAGTCCGACAATCTGAGTGAAGAAACCCAACGGCAAATGGCGGAACGTTCAC
GCCTTTAACAAGCTCAACGCCGCCACCATACCGGCGCAAACACCGATCCCCCGCAAAGATGTGATTATCGACGGCATGGGTCGATCCACCATACTCTCGA
CCATCGACCTGCGCGATGGATTCTATCAATTCCTCATGCGCCTTTGTGACGTGCCAAAGACCGCCGTCTCGACACCAAGTGCAAAGCTTTGGGAATGGCT
CGTAATGCCCCAAGGCCTATCCAATGCTCCTGCGACGTTCAATCGCATGGTCACGGCCAAGTTCCGCCCTTTCCGCGACTTTGCCCCATCCTATTTCGAT
GATATCTACATCCACAGTCGCGGCTCTGAAACCGAAACCGACGTCGAAGTTCACCGTCGGCATCTTCGTGCCGTTCTCACCGTCCTTCGCGAGAATGGCT
TGTACGCCAACCTCTCCAAATGTCAGTTTGGGGTCGACGAAATCCCTGTTCTTGGCGATCTCGTCGGCATTCGTGGTTGTCGGGATCAGCCCGACAAAGT
CAAGACTATCATCGACTGGCCCGTTCCCTCCTCGGTTACCGACCTTCGTCGGTGGCGTGGCTACTTACCTCCACAAGTATTCTCGTGGTTTTGCTGATAT
CGCGCAACCCCTCTTTCGGTTGCTAGTCAGGAATGCCCCATGGGTTTGGTCGAGCGACTGTCAATCCGCCTTTGACGCCCACAAATCTAGTATCAAGAGC
GCCCCAATTTTGGCGCTCTCTGACTTCTCGATGCCGTTCTGCGTCGTGTGTGACGCCTCCCAATTTGCCATCGGTTGTTACTTGATGCAACCTGACGCTG
ATGGTCGCCAGCTCCATGCCGCCGAGTGCTCGTATCCCGTTCATGACCTCGAGCTCCTTTCGATCAAATACGTCCTCACCAAGTTCCGCGTCTACCTCAT
CGGCGCGTACCTCTTCGTCGTGTACACCGACCACGCGTCGTTGCGAACTGCCGTCAACACGCCACACATGTCAGCCCCCATGGCTCGCTGGCTTTCCTTC
TTCGCCGAACACAATTGCTCGGTTCAATACAAACCGGGCAAGGACAATGTTTTGGCTGACGCGCTCTCTCGGCGTCCAGATTACTCCTCGTTTGTGGGCC
TTGCCTCGATCGGATTCCTCCACTCCGATCTCCATGACCGCATCCGAGCTGCCTACTCCATCGGCGCGAGTTGCTCGGCCGTGTTCAGTGCCCTTACCAC
TCTCGAGCCGCTCAAGCCTCGGCGATCACAATCCTTACTCCATCGTTACTCTGTTCGCGATGGCCTACTCTACTTCTAGCCCGCCCAGGACACGCCTCCG
CGCATCGTTGTCCCTGGGGATTCTGCGATTCGTGCCTCCCTTCTGCGCGCGTATCATGATTCACCCAGTGGTGGCCATTTCGGCCGCGACAAAATGTTCG
CTGCGTTGTCCCATTCGTATTGGTGGTCTCGTCAATACAAAGCTGTCGCCCGCTACGTCGCTCGTTGCGACGCTTGTCAATGCACCAAGGTCGCGTCTTC
CTCTCAGGCGCCACTACAGCCTTTACCGATTCCCGATGAGCTCTGGTCATCGGTCAGCATGGACTTCATGTTTGGTCTCCCGCGTGACGCTCGTGGTCAC
ACAGGTATCATGGTTTGCGTCGACAGGGCGTCCAAGTACATCGTGACCGTCCCAGTCAAAGAATCCATCAGCGGCGTAGATGCCGCTCGCCTTTCCTTCG
ATCATGTCTTCTGTCGCATTGGATTTCCGCGGTTCATCGCCTCCGACCGCGATCCCCGTTTCACCTACCACTTTTGGTCGGTTCTGTTCGCGCTCTGTGG
CACCGACCTTGCCATGTCTACTACCGACCACCCCGAGTCGGATGGTCAGACCGAGCGTGCCAACCGCGCGCTTGAGGATA