Description :
From Genome Similarity Track
Location :
scaffold_44:112215- 130229
Transcript NameFunction/comments
g9781.t1 hypothetical protein PHYSODRAFT_557569
g9782.t1hypothetical protein
g9783.t1hypothetical protein
g9784.t1 hypothetical protein PHYSODRAFT_490271
g9785.t1hypothetical protein

Sequence
18014 bases(100 bases per row)
TGTCCGAGTCCACGATCGAGTGCTTCTCCTTGAGGAAGTTAATCTCGTGCTCCGCTTCGCACGTTCTGGTTTCCGCGAGGAGGTGCGGGCCTGCGTCTGT
GATCAGGAAGGCGATCGTGGGCATGGTGCTGTCCAGCGTCAGCAGCTCTGCGAATGCTGCCTTCTGGTTCTCATCGCCGTCTCCGCCGTTGGCACTCACA
CTCGGGTGGCCAGGAGGGACGCACAGCTTCACGGAGGTGATGAAGTCCATCGCCTCTTCCCCTTCCGTGAAGCTGTGGTTCGTCACGAAGCAGCCTTGCG
AGCTCTCCGTAAACGTGATGATGGTGATCATGACAGCGTACTCCTCTTCAAACACCGAAGCAACGAGGTGGCGCACAGTCTCCTTCACGCCTTCCAGCTC
GCTGCCCATGGAGCCAGTGATGTCGAGCAGGAACACGAGGTTGATCATGATCTCCGCGAAGTGGTGGGCCTTGAGGTGAAGTGGCTGGTTGCTCGGAAGC
AAGTTGGAGAATGGTCAGTGTCGGCAAGTCCGAAGGTGGGTGGAAATCATGTGAGACCAGATATAGTGAGTGAAGGTCAACTTCAACTTGTACCACAATA
TTTTCGTGAGTGAGGGTTAACTTCAACTTGTACCATAAATGTGGACCATACGTGGTGCGTTTGTGGTGAGCGCAGGTAGCTGGAATTCGAGGCTACGAGG
TCCGACCACAGATATACTGAGCATACTTTGCTATATTTGTGAAGAACCAAGGCAACTGGTTTTGTATGTCAGCATTCTCCATCATTCAGACAACCAAAGC
TATGCCGGTTTAATGACTTGAGTAAACAGTGTCTGTGAAAATGTCAAGTGTCTGGGATACTTGGTCCTCGTTTGAGGGGCGAAGTCACTCGATGACTCAA
CTACAGCTAGCGATTTTCATCCTTCCTTATTCACCTCCCGCCCAAACTATCCTTGCCTGGCTGTCTGTCCTCCTTGTTCTTGTTGGGCTTGTTCTCCTGT
CTCATCCTCTTCGGCAATCGGCTGGTTCGACGAAAAGTATACCTGTCGGATAATACGCGGGGCCGCAAACAAAAAGATATCCGACAGCACGCGCTGCTCG
ATCACTCCAGCGGCACAAACCCTACGGACTTCTTCCACCTTCTCTTCTCTTGCTCTTGCATGAACATTCTGGGAGAGTGGAGCACACTCAGGAATGCAGC
TTTGCACTTCATGAGTAAGGGTTGGCATTGTCGATAAATGGGTTGGTTGTGAAATTTCCTACATTCTTTACAGAATTTGGAATACGGTGACTTCATCCCG
ATATATCCCAGTCCTCCAGCATCTTCACAATTGCATCCACGTAGTACTCAAAGTTAGGAGCAGTGCCAGCTAAAAAGATGACTGCGGGAACCATGCGGCC
TTAGCAAACATACACGTAGGCGTCGAGCACATTTCGTGAGTGGATTGTTTGGGTCGCACAAAGCCATTGCAAGCTCCGCGACATCGTACCATTGGATATC
TAACTCTTCTGGGTATTCAGTTGTCAGCACGGATGTAAATGCGCGCATGTCTGAAGTGTTCAACCTGCCAAGGCTAAGCAGTAGCAAACCTTCAACAGAA
GAGCGCATACGTGCTCGTTTCGAACAGAAATCGTAAGCCAGCCACATCCACCAGTGATCTCGGTTAGTAGGATCCTGAGCATAAATCCCCAATTCTAGCG
ACAACTTGGTTACATCCTGCGTGTGTCCTACGGCGGAGCACATGGCCTCGAAATCGATGGCTGGCATCATCTCTTCGCATATCAATTCGAGCAATCCTGG
ATCTTGGTCCGATACTTTGACACCAAATGCGGAGTTAACATGTTGATTTCGACGCGTACTGTCAAAGAGCCATCTCAGGAGCTGCCCGAGGGATTTTCTT
GCTGTGAACTTGTTGTTCGTGCCCTCACGCTGAATCGACATGACAAGTGTCAGGAGTGAAAACTGCATAACGTGGTTCTCAACTAGACTGTCCATCACTT
CTGGAGTCCAACAGATACCCTGAAGATCTACCGATGTCGACTCAGTTACAAAAGTACATCTGATTGCTCCACTCTCCAAATCCTCTGGGTAGTACGTATT
TCACTGCTCTTGAGCTTCCTTTTCAGATCCGACAATATCCACTATTTCGCCAAGAGAGGTTGGAATCGACTCCGATTTAGTGTACAGGTCCAATTTCACA
GGAATTTTGATTTCTACTCCAGGTTCCCCAGGATTCACGTTATCATCCAGTGCTGCAATCCAGTCCAGTGCCTTCAGATACTTCTTGCTCGGGTGTTCTC
GCTGATGCGTCCCGCAGAAACGCACGGAGTCGTAATCGATCTTACCGTTCTCGTTCACATATCCCTATACGTCCACGTCTAGCGAAAACGCCACTGCACT
TGTGGCTTCAAACAATTCATCTTCGTATTTCCCTAGCTTGAGGGGGGGCTCCACAATGTTGAGTTAGGAGATACCGCCACGCTTGATAGTCTGCGTGCTC
TACTGCTGCCATCAGCGTCAGAGCCTCTCGGATCTCATGAAACTCTTTTCATCCTTCTCCTCTCGGCGTCTCGACATGGTCACTTGTAGTACAATTTCAT
CCATCCCCACACACATACTCAGTGGATTTAGGGTCGGAATATCGGATGTGAGGCTTCAACACCTCACACCATGGAGCGAGAAAGCCCCAACGCTCGTCCA
TTCTCGAGATCGACAGTCCAAACAGGAAATGGTCGGTGGTTTTGTGCCAACGCGTTGTTTCCTATCTCAGTACATATAATTAGACTTCGTAACGAAGTTT
GTGTCGGCTTCAACAGCAGCAATCGACGACAATGTCTTCGGATGTTCTAGTGGAGCGCACGTACCAGGCGCTCATGGGCGTCGTGCAGACGACTGCCGTG
AGTCGGAAAGTGCTTGCGAGGCCTCCGTTCACATTTCTCCACAAACTGCTGCTAGAAACTTTGAGCGAGTTCGACCTCTTCTCGGAGCAGCAAATGGACT
TTTCTACCCTGATCACGAAGCAAGCCAAGGTACCTACCACCTGCCAACAGAGCAAATGTACTTTGTATCACTAACAATTCCACCCGATTTCCGTCACGTC
GTAGGCTGCTTTCTTAACACGTGCAATCGCATTCGTGACGTTCGTGCTGAGCGCGCATTCTGATCGGCACCACATCTCCTGTCTTTTGCTCGTGAGCCCT
GTACAAGTTCTTGCAGGTGTCAGCGTCTCCGACACGCTCGAGTTTCTCCTCCAACTTTGCGAGGTTTGTCGGATCCCGAATCGCGATATCAAGGATGCTG
CGGCACAACAAGTCCGCGAAAAGGGCGACGCGCACCTCTACTCGTCGGGTGTTATATTCCGAAAGGGGCTCGTGCTCATTCAGGGCGTCATTCGCAGCTT
TCTGCGCCGCCGAGTTCGGAAGGCTGCCCCGCGTCTTAATGGCGCACCCGTGCACGAACAGGAGCTGTCAATGACCGAAGGCACCCGCTTCCTCAAGGAG
TTAGCTGACGGTCGCATCTACAACGGCATTATCCGAAGCGTGCAGAAAAGCATTTTCGTTCTGGGCTACGAGGAGGATGCTGAGGCACAAGACAAAGTCA
GTAAGTATCCCGTCCTTGTACATAGTGTTGCTGCTTCTGCTGCCAAAAATGCTCACGGATTGTCTTCCTCGTGCTTGTATCGCCTCGCCTCGTCTCGCTG
TAGACGAGATCGAGATGAAAATCATCCTGGAGGAGTCCCAGCGTCTCAGCGCAGCTCGCGAAGACCGACTCACACGCAGCGGCAGCAACGAACGCGCTGA
TGGCGATATTTCCCTCGCAGATTTGCCCGACTTGACGGAAAGCGCCTACCCACATGCTCCTGGCTTCATCAAGCGCGTGTCATCACGAGATTCTGCGTCA
TTGCTAGGGCCCAAAGCGAGCAAGTCGAATTCACTGAAGCGCGCTCAATCCCAGAGACCTTCCATCACGGAAACGGAGCTGTTCGGTCTCCCCTCGAGCA
ACTCCCTTCTGAGTAGGAAGTCCACAAGCCGAAGCTCATTTGCTTCCATGAATCAACACAAGGGAAGACTCACGTCGAAAACAACCAGCAAGAGGCAGGC
GAACTGCGCCGACGAGTTTCGAAGAATGGTGACTGGCAGAACTCGCTTAAGAAAATGCTCGTCGAAGGTAGAGACGCTCCGTTGGGACCTGAAGGGCAAG
ACACACAAACGAACCAGTTTGCGGACACTGCGGACGGGTACGCTCAGTGTTGCAGCATCTCGTTTCTGATCTGGTTGACGAACTTGTTTTTTGTTGTTGC
AGAGCCTCAGCTCACATCCCAAGCTTTCCGAAGCTTGGCATCCCTGGTACGAAGCCGCTAAGACCTCTTTTGAAACGTGGCTCTAGTGGATCGATTGCAA
GTGCACACAACAAGGCCCCGCAGAAGGACCCGATGCACTCTTCACCAATGGCCCAACCTAATAATTCCTCCGCCGCACCTGCAACACGAGCTTCACCGTT
GCAACTTGGAGCCAGCCAACTGAGTATTCAGAGAAGTGGGGCTCCTGCTAACGCGGCCAGCGTTCCTCCCCCCTCTGCTTCTGCTGAAGGGGTCGTCGAC
ACGGCGTTCGCTGGCACGTACCAAACGACCGACCAGCGTACCCAAGAAAAGCAAGCTTTGATCCGAGACATCGTGATGCGCATCGACAGCTACATGAAGC
GCAAACGCCTTCGCGTGATCGACCTCTTCCGCTTCTGCGATGCCGATGGCAACGGCAGTATTTCACCCGACGAGATGATCGACACGCTATCGCAGATGGA
GATCCAGCTAGCACCCGACCAAGCCCGAGAGTTCCTCCTACACATCGACAAGGACGGGAACGGGTCGATTGACGTCGATGAGTTCGAAGAGCTCGTTCGG
GTGGCGCGTCGCAACGAGGCCCAGCGCGAACAGCTCAAGAAAGAGCTCAATGGACCGAGGAAACAGGCAGAGAGCAAGTCGTCCCAGAAGCAAAGCGCCG
TCATGAAAGCCAAGGCGAAACAAAGCATTCTCGACGAGTTCAGAGCTGCGCAAGAGGAGGGAGGCGATGGGATGAGTGCCAACCAGTTGCGTTCTCTAAT
CGGGCGGCTGGCACTTCCTGGGCTGAACGATCCCTTCGTGAGCTCAATAATCGACCGCGCAGTGGAAATCGCTGCGTCGGCCTCTGCTCCTCTGTCGCCT
CCTTCCGGTTCTTCGTTGGTATCGTACCATCACCTTGCAAAGGCGCTGGACGAACTGGAATGGACCAACAAGTCCAACCGCTTCCTCGACCAGTCCTGGA
TCCGACAATTCGACTCGCAATTGGAGCGGGCGATTCGCGAGTACGAGATGCTTTGAACGGGTAAACCAGTTCGCTACATTATCATAGAGGCCATAAAGTG
AAGACTTGTAAGAAGGACATGCTCGAAGTCTCAGTACCTATCTAACTACGCTTCCGGTGCGTTCGGTGCGTCTTGCAGAACGCTTGCAGCTGCCCCCCTT
CTTTCATAAACATATCGTAAACGCCTCTGGTCTCACGACCACACAGCGGGTGGAAGTACGTCGAACACGAACTGCGGAAGCATTTGATGCAGCCGTCCTC
CTGTTCGCACAGAGCACAAGTCGAGCCCTTCATCTCTTGGACGGCAGCAGCCACGTTCTTCACCCCACTCATGCGCTCCACATCGGAAAATTGAACACCG
GGGGCCCACAGCGCACACACCACGTGCACCCATTTGCCCTCGCACGTTTTCTTGAACGCGCTCTTCTGACGTTTCAGAGGACACAATGCGCACGTCTACA
ACAAACAAATGTCAGACCCCGATCAAAGCAAACGTCAGACCCCGCTCAGCACTACACGTACCGTGTCAGCAGGAGCACCAGTCGGTTCCGCACAGAAATC
GCAGAACCACGGCGTGTCTCCTTCCGGCACTGCATCGATGCCATAACAATACTGCACACAAAACAGCGTCAGCATCAAGTTGTTCCGACGATGAGCAAAA
CTGCTGCACCTACCTGGTGAACGGCAACAGAGCACTTCTCGCATTGCACAATAGGGTCGTCAAGGAAGCCTTGGTCGCTGAAGCATACACGGCACCACAT
TTCGGTATCTTCTTGGGGGTCAACGTCGGCCTTTACAGCCTTCCGAGACTTTGCCTTCTTGTGGGGGCGGCTCCGAGAACGCTTCTTTTCGGTTTCCTCC
TCCTCTTCCTCGTAGTCATCTTCCTCCTCCTCCTCTTCTTCCTCTTCCTCTTCCTGCTCCTCTTCTTCCTCATCCTCTGAACCACTCGCGACGTGCTCTT
CGTCTTCAACCTGCTCTTCGTCTTCACCCTCCGCGGCATTTTCCCTTCGGCTCGGCTCCTTGCTCTTAGTAGGAGTAACCTCGGTTGGCTCTGCGTCGCC
GGACGATTTACTAAGCTTCTTTTGCACCTTGCGAATTTTGCTCGCCACCTTTACGACGCTGAAGTCTTCAGTGCTCTTCGATCGTTTAAGTGAAATGTGA
ATACCACTCAACATACGGCCACCCGGCGATGAGGCTCGAGAGTTTCTACCGCCGGAAGCTTGGCGAGCAGCCTTCTTGCGCTTGGGCGGTTCAACTTCAT
CTTCAGCAAACTCTTCGTCGTCACTCTTGTACAGCTTCTGATCCTTACTCCGGCCATTTGTTTTAGGTGCTTTTTTGCGGCGAGCACCACCTCCCTTTTT
GTTTTTCGGGGGTTGCTCTTTCGGCCCGTCAAGGAATTCAAGATACATCAGCTGGTCTCCAATGTCTTGGCTACGCCGACGTCTGGGTCGCTCAATCACC
TGAAGCCACTCGGTGGCCACCTCGCGAACATTCACAACACCCTTGATGACGCAACCGGTAACCTTCAGCTCAATCAAGATCGCCAGTACCTGGTCTGCAT
CTGCCAAGGACTTGCCTCGTTGTCGCTCTTTTACCACTGCGCGAGCCAACTCACGCAATTGCGACATGAAGTCTTTCACCTCGTCTTGTGAAGCCGTCTT
GAGCCAGCCTTCTTGGACCTTCGTCATCAGCACTTGTACAGGCTTTGGCCCAAGAACCTTCTCCCAGAATTTTTCGTCGTTGAAATCAATCGTCGTGTCT
GCCGATTCAGACGTGAAGGTTGCCTTCGAAAACGACAGAGCAGAAGTCTGAGAAACAGTCGCCGGCTTTGTATCATTGTCGCCATCTCCACCATTTTCCT
CTTCACCATCGGCATTTTCACCACTTTTCGTAGGGTCATATCGAATGGTTCGACTGTTCGACAGCAGATGATCGATATCGAGCTCGTTGATGGCGCGGTT
TTCAGGGTCCTGCTCATCCTCTTCACCCATGATAGCGTATGCTCCGTATCTGATCATCATCTCGACCTTCTCACGATCCAATGACATCAGAGACATCATG
TTCCCGCTACTGTCATCTTCTCCGTCAAACTCGTTGCGCACTCCACCAGTCTCAAACACAGCATGGTGCATTCCGAGCTTCTTCGACGCAATCTCAAACA
TTTGCGCTTCGTACGTTTTCTTTGTCACCAAACGGTAAATGTTCACCGACTGTGTTTGCCCGATACGGTGGCAACGCGCGACGGCTTGAAGATCGTTCTG
AGGGTTCCAGTCGCTATCGAACAAAATCACTACAGATGCCGCGATCAGGTTGATACCAACACCACCGGCGCGGGTACTCAGCAGGAACGCGAACGTGTTT
GAATCCGGGCTATTGAATCGATCAATTGCAGCCTGACGAGAGTTTCCGCGAACAGATCCATCCAGGCGCTCCATGCTGTAGCCTCGTAGCTGGCACATAT
CTTCAATAATGTCCAGCATAATCTTGAATTGCGAGAAGATAAGTACCTTCTTATTTTCCTGGCGGAACTTTGTCAGCAGTTTGTCGAGCAGCACTGTTTT
CCCACTTGCTTGGATTAAGACCTTCATTCGAAGCTGCTCATCGAACGCGGCGCACTCCTTATCCTCCACTCCACGAATTAAGAACGGGTGGTTGCAGCAC
TTGCGTAGCTCCATTTCCACGTTGACCAGATTGGCGACAGTGCCTGTAGCACCCATGTTCAAAAACTGGCGATTCCGCTCAAAGATGGCGCGGTAGTACT
TCTTCTGCATCGTCGTGAGTTCCACGTCGACGATCGTCTCTTCTTTCGGCGGAATGCTTTTCTCAACATCCTCCTTCACACGACGCAGCATGTACGGTCT
CAACTGTTCATGCAGCTGCGCAACTTGTTCTGCAGTATTTAGATCGCCAAATTCATCGTAAAACTCTTGCTGACTTGGGAATTTATCGGGCTCAATGAAG
TTCAGTAAACACCAAAGCTCGAACACACCATTCTGCAGCGGCGTGCCCGTCATCAGTAAACATGAATCCCAAGTAAAACCATGGAGCACCTGGAGAAGCT
TGGCCTCGCGGTTTTTCAGCTTGTGTGCTTCGTCGATAACAATGTACCGCCAATGAATGGAGTCGAGAAACTCTGCATCCATCATCAGCGTCTGGTATGA
TGTGACCAAAACATTAAACTTGTAAATCCCGCGTCTGCGATGAGCTTCGCTCGCAAAGTGGAACTCTTGTTCACGAATGAAAGCACGGATATCAGATCCT
CCCTCTGAGTCATGATACACAACACAGTTCATCGAAGTCCACGTTTCAATCTCTCGCTTCCAGTTACCCAGCGTAGCAAGCGGAGCTACGACTAGGAACG
GTCCACGGATAAACTCTCGTTGACGCAAATGCTCGAGGATAGAAGTTGCTTGAACAGTCTTACCCAGACCCATCTCGTCGGCCAAAATACAATTGCGACG
GTTGTACCAGCAAAACGTAAGCCAGTTAAGGCCTTCAAGCTGGTACGATCTTAGGTTGTTCTGGTTGTTGTAGACTGGAGACTCCTGGTATTTCGCCCAC
GTGCTCGGTTCTGGTCGAACATCAGCATAAGTCGCAGGGTGGGCGCCGTTGATAATAGGAGGATGGTTGAAACGTTGGAAGGCGGCGATCTTACGATCGT
CGGTGAGCTGGTCTTCCCATTCCCAAGTGCAGTCAACGTAGCTCATGTCGCGCCACTTCACAAGGTATTTAATTCCCTTCCTCTTTGGCGCCTTCGGTTC
ATCTTCTTCCGTATCGCTAGCATCCTTCTCAAGAAGATGGACTAGGTACGGGTTCGATTCCACAGGCTCCTCGACCTCCTTCGCGTTCAGAATTCGATCC
ACTTCAATGTACGAATCACTAAAGTAGTTGCTGAGGTCCTTCTCTTTTCCAACGATAACAGTCTCCCGTGCTTCCTCCACTTGGCGGCTATTTTTCTGAA
GATATCGCTTCATTCGCTGGATCGCGTGTTGACCGAACTCTTCGATTTCTCTGACAGACAACCAGTTCACATGGAGATAAGAAGTGTCCTTCCACTTGAT
GAGGAACTCCATATAAACCTCGGAGTTCTCGGGCGTGTCCTTGTGGAAACGGACGCTAACAATATTGTCGATTTGGGGGCCCTTCGGAGCTGCCTTCGGT
TGGTCCTTTTTGACTTTCTCTTCATCACTAAGCTCGAAATCAAGCTCCTCCGCCACATACTTCTTTTTCGCCTTGCCGGCGTTTCGTCCTGATCGACGAG
CGGGTTTTTCTTCCTTCAAAACCTTCGGGCCCGAAAAGTCATCATCTGAGTCGCTTTCATCCTCATCTTCATCCGAGTACGCTTTCTTCTTTCCGCGTCC
TCGCTTGGACTTCTTGATAGGCTTAGCAATAACGGTAGGAGCGAAGTTCTTCCGTTTCTTCCGATCGGCTCCTGGCTGGATATAGTTGTGAGCTGTCGTC
TTCAACGCACGGCTTAGGATTTCATTCGGAATGTTGCCGCCAGTGGATGTGAACTTAAACACCATAATCTGGGCACGTAGCTGCTCCTTTTGCTCCGCCG
TAAATGCAGCACGAAGATGTGGTCTCCGACGCTGAATTGGCTGCATTTCGCGCATGTTAGACATCGCAACGGGGATATTTGCATTTGCTCCGTTGCCAGC
AGGGTTCATGAACTGGAGTGCTCCATTGCCGTATGTTTGATGAATGTACTGGTTGTATGCCACGGCTGCATCTTTCTCCGTTGAGAAGACTCCCAGTCGT
CGAATACCCCCACCATCCACATGCAGTTCTGCCGCCCACTGATTCGGACACAGATATCTAACGCCCATGTGCCACATGCCAGTTGTGAATAGTTGAGCGT
TGTCTAGACCAACAATCGACGTTTGTTGCCCCTTTCGGTACCCATGAATATCCCGGTTAAGGCTGCTCGCAAGTCCGTTTCCGCCAGGTCGTCGGAAGCG
TAATAACACAGGTCGGAGCGACTTGAGACGAGAAACCACACGAGCAAAGTCTTCCTGGCTTTGAACGAGAAACCCGTCCACCGCAATCAAGTCATCGCCT
ACAGAAATCATACCACTTGCTTCAGCTGGGCCCATCAAACCCCCTTCGGGCCGACGAAAGCTCGTCACAGTTACCGATCCCATGCGAACGCTCATATTCA
TGCACAACCCGATAGATCCCTTTTGAAGCAGGACCTCATACTCGTCACCGGGAAATGGGTTTTTCCATCCATGCGCCCTCGTATTTTCGGCGCCAACTGA
GGCCCGCAAGACATCGACTGCAAGAGCACTAGCTTGCGCAGGGGTGGATGCATTCTTCGCGTAGGCCCCCAAGCGACTCAATTTCGCACGTTCTAGCGCA
AACGAATTTTCGTCCAAACGCTGCGGGACGAGTGATTTGGCTGGAAACGGAGCTGGAGTCAATCCTGGATCGACGCCACCTTGCTGCTGTTAAACAAAGC
ATAATATGACGTGTAACGTTAGCGAGATAAACAAGTTAACCACTGTAATCTGGCACGTACGTTCGACCCCGCAGCAGATGGGCTCGTCGTCGTTGGAGCT
CCAGGCGTCGGTTGTGAGTTCCAATTTGGATTGTTTTGGTTGTTTTGGTTGTTCTGGTTGTCCATGCCTGCAGAGGTCGGCTGGTCTTGCCACTGCTTAT
CAGGTGACTGTTCCATCATACCGGGTCCAACGGGAGGGCCATCTTGCGGCGTCGTGTAAAATGACGGCGCGTTCGTCTGGTGGTAGAACATCTGAGACTG
GGATACAGCATTGCCACTGGTAGCAGTGATGTTCGCGGCGCTAACGGTCGGTTCATCAACAGGAGAGGCTTCGTTCGTGCTGCTTGGTGCGTCAGCGTTA
CTTGCTGCATCACCCTGCTCCTGCGGTTGCTGCTTCACAGCACGGGGATCTCCATCGAGCGGGCGAATGGGTGTTGGTGATGGCGCTAGGAAGTTGGAGG
GGGCAAATGGAAACTGCATCTGACGGTTGGCATTCTGCTGCGTGTCGACACTCAGTGGCTTGTTGTCACCGCTGTTCTCCACCTTCGTGTCTTCTGATGG
TTCATCAGCAAGTTCTTCGTTCTGCTGTGGATCGTGCTCCTCGTTCTTGTGTGTCTCGTCCTGGTCTTCCTCCTTCTTTAGATCCTCCTCAGACTCAGTT
GAAGCCTGCGGTTCAGTAGCAGTCCCAGCCTCTCCTGACGTCATCTTCTCCTCCTTGTTCGTCTCTTCAACTGCAGTGGCGCTGAGCCCTGACGTCATCT
CCTCCTCCTCCACCACTACCTCCTCCACCACCACCTCCTTCACCGTCTCTTCAACTGCAGCGGCGTCCGTCTCCTCCTCTACCACCACCTCCTTCACCGT
CTCTTCAACTGCAGCAGTGTCCGTCTCCTCCTCTACCACCACCTCCTTCACCGTCTCTTCAACTGCAGCGGCGTCCGTCTCCTCCTCAGCTTCGGCTTCC
TCCCCTTCCTCTGCATCTGCCTCTTCTGCAGCCTCTTCTTCTTGCTGCTCCAGCTCTTGGGGCTTCTCGACGTCTTCCTCTCCTTCCTGCGGGTCCTCCA
TGGGCTCGTCCGCTGTCTCCTCAGTCTTCTCCACTGGCTGCGGCACGTCTTGCTCCTCCTCGGGACTCTCCGCCGGCTGCGGCTCCTCCTCGCGCGGCGT
CACGTCCTCCATCAGGACACGCGCGGCCTCTGTCGCTTGTGGGCGCCTGTGGGCGTCGGGCTCTAGCTGCTCGTGACGGACTCGCGGCGCCGGATCTTCC
GCCAGAGGAGAGTGAATGCGCTCCTTTCCTTTGGCTTCTCGGCTTCTCCGCATTATGCGGCTCGTCGTGGCGAGCCCCCTGTTGTGCGTGCCTCCCATTG
GCCGAAAATAGGGATAAAATAAAACCTCTTGATATAAAGTATGCAGAGTAAAACCTCGCGACGGATTCGAAGGGGACTCTTAATCCGACCACTCTGTCCG
ACTGAATGTGTCCCAAATGCCGCGACTTAAACCGTGATACATGGAATGCGTAGTGATGTCCCTGCTTCCTGGTGGCGAATGCAGTGCATCAAGGCCGCAT
TGCCTTGATGCAGGGATCCATACGGACAGACGGTGTGGCGACTAAGAAAATGGGCCGGATCGATGTTAAGTGAACGCAATGCTGACAAGGAGCCGCCCTC
CGACAGCAGCCTGGTCAAACATGTGCATGAAGCCCCCTTTCTACCTCGCCTCTCGCCATGTCGGAGGTGCATTCTTGAAGCTCTGCTGTATCCATCAAAT
CGCAACGTCGGACCAAAGACCAGCGTAACGTGAGAGAAAGGATGGGAAGGGGCACCAGCGTCTCGCCATTCGATCGCAATGTTGCCAGCTCAAGTGTATT
AGGAAGCAGCAGTTACGTCGCGAATGCCACGCACGCGCAAACATCGATCTCGCTACCTACCGCCTTCAGCCAGCCGACCGCAGAGTGATTCGTTTCCGTC
CTCACACTCGATGTCTGTGACTGCTGCTTTACGCGTTCGTGGACACGCCGTCCTTGTACTGCGGCTTCAGCTCGTAGCAGCTCTTGTTGGGACCCTTGCG
GTGGTACACGCAGATCTCCTTCAGCACCTCCTTCAGGAACGACTGCAAGAGACAAAGGGCACAACAGAGAAGTGTATCAGTATCGATTGCGATAGAGATA
GGCGGTGGTGAAAAACTAGTAAGGCACCGCAACTGAGCAACAGACACAGCGTTACGCACCTCAGGCTGACGGCAATGGTAGTTGAGCTCCTTCAGCGGCC
AGTAATCGCGTTCCTCAAAGTGATGGAACACCAGATTCTTCAGCTCATCCTGCGAAAATACAGTGCGCGCACAGATTAGTTAGACGGGCAGTTGGCGTAC
CAGGAGCTGCAAGAACTTGGTCGTACCTTGCTCATCTTGATCTTCTTGTCCGACCTGTCCAGAAGCTTCGAGTCGGCATCGTCCTGAGAATACGAAAAGG
CAGCCGCAGTCCTAACGAGTGAGAAACAAACGAATGCATATACACCCAAAGCAACCGGAGACCCACCTCTTCACCCTCCGCATCGGGCTTCTCAATAGTG
AACTGGATTCTCGCCTTCTTCACGCGAGGTAAATCCTCCAGCGGCTGCACAATTCTGTCAAGTATGCATATAATTAAAATCGAGCGATTGCCATCACAAA
ATTCAACGTTAAACGCTTTTCAGCGCTCCGCACCTCGTTTTGACCATCGACTTGATCAACCGCTGCTTGCACATCTTGCTGTACTGGTCGTTGCGCTGGG
CCATGACTGTGCAGCTGTTCTTCACAGTGCCTTCGATCGCCATACGACCAGAGCCATCCAGCGAGAACACCTTGAGCTTCAGCGGAGTCTCGCTGACCTC
CACGCGGTATTCCGTCGGGATGTCGTCCACCAGCGTGCTCGGATTCACCGTCAGCATTCCCTACAGCAATCACCGCCAGAATATTAGTCAGTGCAATAAC
AGCAATGGCTGCAGTGCCAACAGTGACAGCATTGATCTGCTGTTTACCTTGCGACGGCCGAGGGCGCTCTTCTTCTCCAGCTTGATGGAGCCTAGCATCA
GTTCACTCTCTGCAATATGCACATAAATAAAGATCGCCTATTAGCACTATAATTGATAAGATACTGACAAGCTTGCTGTACCTTGCACGTTCTTCCAGGA
CGCGCCGAGAGCCGTCTACGCAGCCAGTGGCAACAGATAATCGTCAGTTCTGGAGCCGACAAGTCATCAATCGCAGCAGTAGAAGCACTCTAGAACAAGT
TTAAAGACACTAGAAGACGGAAACGTACCGGGATCTTGGCCAGGTACACCTCGCGGTCCTCCAGCTCCAGGTGCAGCGGCTCCACCACTTCCTCGGGTTC
AGCCATGTTTCCCTCAAGCGGTTGTATCGGGAAATGAACCTGAAAATGCATTATAGTAGGTTACCTCTCATAATATAGTAACCCGTCTTATCGGATCGCA
TGTTGATGTTACAGTATGGGTTTACAGAGGAGTAAGATACTGTATGATTTTTCATTTCGTGGGATCAGATGTGCGTCATTCGAACACCTCGTTCGTCATG
CCTGCGTCTGTGCTGCTGCTGAAGGCAGCGGATGACAAGTACAAGAATGCGCTGGAGCAGATCCCTGAGGATGGATCTTGTCGCCGCGCATTGGGGGCAC
ACTTCACGGACGTGTTGACGTTCGAGTACCTCAACTCGGAGCTGCTGTTGGATGTACTGACGCACTTGGAGCGCTACAGCGGCATCCTGGTCACGAGTCC
GCGCAGTGCAATTGCCGTGGACAACGTGGTCAATGGTCTGGATGCGGGTCTGAAGCGGCAGGTGCTGGACAAGTTGCGAGCCATTCCCGTGTTTTCTGTG
GGGGCTGCCACGTCCCGAGAGCTGTTGCCGCTCGGGGTCGTGTGCCAAGGCGACGACGCCGGCTCGGCGGACCTGCTGGCCGAGTACTTGCATCAAGACG
GCGTCCTGCCTGCAAATTGCAAGGACAAACCGATGATTTTCCTGTGTGGCGATAAGCGTCGTGACACTCTGCCCAACAGCTTCCGATCGCGCGGTCTCCC
GCTGGAAGAGCTGGTCGTGTACCAGACGTGCGCTGTGCACGACGTCGAGTTCCCTGCCGAATGCAAAATACCCGACTGGATCGTGTTCTTCAGCCCAAGT
GGACTGAAAGTGGTCAAAGATCTGCCTCTGCCTTGGGAGTCCATCCGGAAGGCATCTATCGGTACGTAGCTCAGTCTTCATGCTCAAGCGAACTAGTTTA
ACTCTTTCTGCTGCCAGGCAAGACAACGGCTGCTGCTCTCCACGAGCACGCACTAGCTACGGAGCAACCTTTCTGGCAAGCAGACGTGGTATCGCCCAAA
CCCAAGGCCGAGTCGCTCGCCGGCGCCATCTTCGCCTTCGAGGAAGAGCACCAACTGTGAAAGGGAGCAAGTCCCTGAAGCTGCCAAACAAGTCCAACAC
ACAACACTCGCAGTAATTGACAAAGGCTCGATGCTCATTGTAGATTTAACACTGGAGTCCCTCCCCGTCATTGTGTAGGGGCGACTTTTTCCTCTCGCTC
TCTCGAGAGTTACTCTTCGTCCTCAGTCTTGCGCGGCTGCATGGCGAGCTTCAGAGCCTGGACAAGAGCACAGTTAGCGGCTTATACGTCCTTATTGAGA
CCTTTTAGGGGACGCACGCACCTCGGCGCCTTCCCGTCGCGCGTTCCAGTCGGCGATGGGGCCCGTGATGAGCTGCATCGAGGCCAGGACGATGCCGCCG
GTGAGCAGGTAGCGAGCGATTCCGTTCATACTGGAGGCAAATGGACTTCTGCGGCTGCGGCGCGCCCCGCGGAATCGTCAATAAATTACAAATATAGACA
ATCAAAATAGCAAATCGAGGTGATGCGTAGTACCAAAAGTGGGTGAGATAATATATGTTGAAGTCAGGAGGAAAGCATTGCGGATATTGAGCTCGCAGCG
CCATCCGTTCATTGCGCTACTCGCCTCCAGTGGATGCAGTGGATGTAGCCTAGTCCAACGATGGTCAGCGGCGATCGTCGGCCGTTTGCTGTGGACAGAC
GATGGGCGCTCACCTCGTCTCAAAGAAAACATCATTTGAGGTCAGCACCAGAGCCACGACGGAGTGTCCGCAGCGGCGTATCTTGCTCGGTCTTGGGGCC
TGAACCACCAAAACCAAGTGTCTCTTTCTTTTCCTTGGACCACATACATGTCAGCTCACTTCTCAAATCGCCTCTACAGACGCAAGCCACTTCAAACTAG
CACCCAAACCATGAAGATTTCTTTGTTTGTTGTCGTTGTCATGGCGGCTGCACTATTCTCTTCGGAAGCCAACGCCTCAAAGGAGTTCGTTGCGCTGATC
CCCAACGGTGGTAACGTGGCCAACGCACCAGCCATCGGCCACTCGGACAACACTGGGAAATCCTCCGCTACGAACGCGTTTGGCAACGCCTTCGCCGACG
CTGGGAAATCGTGGACGTCGGGGCTGTGCCAGGCAGACACCGACGGAGACAGCCAGACCAACGGCCAGGAGCTAGGCGACCCGTGTTGTGAATGGACCGT
TGGGTCGACACCTCGATGGACGTCGGGCGTCTCGCATCCGAGCGACGCCTCCAAGACGTCCAACGAGAGTCTTTGGGCCAACATCAATTGCACCGGTGTC
ACTACCGTCTCGAATTCAGCTGCTACCCAGAGTGCTCCGTTCATGGGCGTTGCACTCACTGTGGGTGCCGTGATTGTGCTAGGCGTCATGTAGATCAAGC
AAAACGCAAGACCCGTTTTGAAACTGCTGTTGAAATCAAGAAGTTTGCATTTGGTTCCATCTTGGTGCTCACAAGTTGCAGTTTGAAGTGAGTCCAGTTG
CAGCAGGCACGAACACAAGCCGATGTGGGCGTCGGACACGCTCAGAATAAGCTTTCAGGGACCAGGCTGCTGAAACAAAAAGACAACCGCATTTCAGTAG
CGCCGAATTTTCGACTACCAGTAGTCAGCGTTCAACCGGCTTGTTCGTTAACATCCGTTTCGTGTGCCTCCGCTGGTTCCGGAGGTGCGTCCAAACTCCT
CATTTGCAAAAAGGCACGGACACGAACAGCACAAGACCAGCTTCACCTTCGTGTTCCTGGAACCATCGGCCATGAAGATCACCAACCCCAGTACTCTCCT
GCTCGTTGCTGCCGCTGTCGTGGCGCTGTTCGTCCCTGAAGTCAATGCAAAACCGGAGTTTGTCAAGCTGATCCCGAACGCAGGCCACGTGCCTGGTGCG
ACGGCCATCGGCCACAAGGACAACACGGGCGCCTCGTCGGCCAACAACGACTTTGGCAAAGCATTCGACAATGCAGGAAAGGTTTGGACGCTGGACCTGT
GCGAGGCCGACACCGATGGCGACGGACAATCAAACGGCAAGGAATTGGGCGACCCGTGCTGCGAATGGACGGTGGGGTCACAGCCCCGCTGGTCCTCTGG
GGTTTCTCACCCTAGTGATGCCTCCAAGACCTCGAATGAGAGTCTGTGGGCCAGCATCGACTGCTCCAATGTCACCAAGATTGCTGCGACGTCTGCTGCC
ACCTCAGCCACTGGAACCGCCTCGATGGTGGCAATCGCCTCGTTGAGTGTAGTCGCCTTGCTGAATTTTGCCTAAAAGCTCCCGCCTTGAGGCTGAGTCC
TCTTTTCGACGAAATGCCCTGGAGCTTACGGTCTCGGACGGATGTTTTACTAATGAGCAAAAACTATAAATTCAATTTGCAAATGCTCTCGGATCTCTAG
CGTCGAGAAGTTTAGTATCATTTGTCGTCTTCTGAGCTCAGCACACTCGTTCTGATAACCATATTCGTTAACGTGTGCCGCGGTGCCTATCGCAGTCTCA
TTCGCGTGCCTCTTTGCTAGTCATCTCGCAGCATGCGTGCCCGCGCGCAAATATATTGGTTGCTTTGAGCGCAGACTGAACTCCTACCGTAGGCAAGTGA
TACCGACGCAAGGGGGCTCTGAAACTGTGCAGAACCATTTGATTTTCGCTTTGTTCAGCACTTTGGAGTCGCTTGGGCGATCTAACTGATAGCATCGAGT
AGTTGTAGTTCTTGCCTCAGAAATATATTCCACAATCTCCAACACTTCGTATCATTTTGGTATCCGAACACCGATTTGTCAATACAAACGGTGGCCCCAC
TTAGCGACGATCCA