Description :
From Genome Similarity Track
Location :
Scaffold_6:1122042- 1129853
Transcript NameFunction/comments
Physo_304520Hypothetical protein
Physo_433733PREDICTED: uncharacterized protein LOC100909061
Physo_404832Hypothetical protein
Physo_513718Hypothetical protein
Physo_304521Hypothetical protein

Sequence
7811 bases(100 bases per row)
TCCCTGGATACGGAATGTGCCATGCGAAACTTGAACATGGCGTGAAATTTACACCCGATCCTGAGGATCCAGTTTGCAGAGAGAGACGAATTAGCGGGTC
GCTGGCACTAAACTTTGTCACGTTCGAGACCCCTGCTGTGCTGATGGAGTTGCTGACGCTGGTAACCCGCGGCCTGCGTTCGTTAAGACTACTTGCTAAC
GACGACGCTGCAGCGTCGATGGGTATCGATCTATCCGCGCTGTCTTCGGCATGTCCCGGTCTTCAACATTTGTCGATTACAAAATATGGTGTAGTGGTGT
CTGACCACGGCGGGTCTTTACGTCGTTGGCCTATCAAGACGATCGCCTTACGAGAATACTTGTCTGACTTGATCGGATGCTTGAGGGACACCACGCTACG
AATGGCTCGATCGTCAAGGTTGAAGTGACATCTCGACGACGTATAATATTTGAGGAGGAGATGAGGGAGCTCAATGCCTTCAACCGCGGTAGCCGGATTT
TTAGGTCAATCCTACATTTTGGTCACGTGTCAAATCCTTACTTTGGTCACGTGACCTAAGGGAATGAGGTCACATGTAATTCACAAACGATCAAGAAGCT
AAGTAAATGCATTATATCAATTCTGCTGCAACGCCATCCTGAACGATACCGACTTCCGCACCATTATACAATTGCTGATGCATCGCCGTCGTAGTCAAAT
GAGTTATCTGGACTGTAGTCTGCCGTATCGTGATCCATCTCAGCAGCGTCGTCCTCTGAACCCGGCGCACTTGAGCAGGATGCAGGGTCATCCGTGGCGA
TGGTAGGCTGCTCGTCTTCGTCTTCGCTTTCCTCCGAATCCACGATGTCGCCGACCTCAGGCAACTGCGGCGCACGCGGCAGCTGGAAACGTTTCCGTTG
AGGTGGCCTGACGAGCCCGGGCTGGATAGCAACACGCTGCGCCACATATTCGCGAGAAATACGCTCTAGCGTGTCGACGAAGATGCTCATGGCAGGGTGT
GGAGCTTTGATCTTCCCGTTCAGATGCCGGTGAAAGCGCTCGAGAGGGTTGTTAGTCCTACTAACAATGTCACGACGCATGCCGAACAACGTTATCCAGG
TCAAATGCTGCACGCCCGTCCGCAAGCTTGCGATGTCCGAGAAGATAATGGTCCAAGAGGTATGCAAGATGAGCTCGATGGCTATAGTCAGGTGACACGT
TGCTGCTGCAGGATAAGGCGATACTGGAGAATTTCGACGAGTTCGTGAAGGTAGCAAGATCACGAAATGGGGGCCCATCTGAAGCTAATAGGTGCGTATC
TGTAGGGAGGGGGAGGGCTCTGTCGACGAAATTGATCCTGCAGAAGCGATGATCACGAACAACTTTGACCAGCTGGACAAACCGAGGGCTGGTTATCGGA
AATGGTCTTCCACATGAGATGACATTCATGAACATGTAAACTAGTTTAGGCAACGAGCACATTTCACGACCTTGCTCGTAGGTCGTCAAGGATAGACGCA
AGATTGATCCTAAAGTGTGTACCACTTCTAGTACTAAGAAGGAAGCAATAGAACTATCAATGCCATCACACATTAGTTGAAATCGATGCTATTATTCAGC
AAGTCACGTTTTACTGATCTACCTGCAAATTCAACGCGGGTGGTTCCACTGTAGATGATGTTTGTTCCTGGTCTCGTCTCACTTGCGCCGAAATCCGCTG
TTGATCTTTCCATTGCTTGATAAAAACGGCTTGGGCTCGATAAATCGGAGAGCTCCGCTTGAGATTTCCATCTGGGGTGAATACATTTTGGGGGGGGGGT
AGAACTCGTGAAATTTCTGCCACCACGTCCAGGTATCGTTTTGGCGCAAGTGTGGCTTCAACTTGTCGGTCGGATATGTGCGTTTGCACAACGAGACACG
GTGAGCTTCGTAATAGTCCGTCTTCTGAGTAGCTGGTCGACACTCAAACCGACACACTGTACACTCGCGCATTGACCGGCTTCGACCCTTCAAAACTATC
CATGCTTCCTTCGCCACACATGGCGCCAGAGTATCTCGCGAAGCTGCAGTAGCATCCTGCGAACACGCTGCAGGCTCTTGCAGGTTCGGCGCAGTCTTGT
CGTTTATGTATATCATACCTTTATCATTTTCTAACCATCGCATCCAACTGCCATCAAAAAGCTCTCGGACCAGCGAAAGCACGAAGAACCGATGCGGATC
TCGGTTGCTAGAAGCGGATGAATCACCAGGATCGTCGTCCGAACCATCGTCACAGGTAGGCGTTTTACCAGCCGCAAGCTCGTGGCATATGTATGCATTG
CAGCGCGCTATGTCTATCATAGACATTCCCAGCTTCTTGTGCCACCTTTTAAAGGTGTGCCCATCGGCAATTGAGAACCGGCCTCGCAATTGGTCGGCGC
GGTCAACGCCTTGCATTTTTCTCGTTATAATTCTTCACACAGGCAGGAGCAGGGAAGGGCACTTGCTCCTCGATGCATATTTGATACAGCGGAACTATCA
GCGTTGGATACGACGTTGACGACCGACCCATCTACCCAGCTAGCTGCCACGATGTGTTTTTCAGTGGATACGCCTTGGTTCATATCACCCCTCTCCGTGG
TCTCGTCAGCGGCTATCATCGTAAACTTGGGGAAGTGCTTACTGGTTTGACGAACAGTTCCGCGACAGTAGAGTCCAATTGTCCGCAGTGATTCCAGCAA
CATACAAGACGTGTATAAGTTATCAGTGTTGACGATGTGCCGTGATCCCTCCAATGCAGCTGTCACTTCGATTACATGAGATCGAATATGCCTTGATTCC
GCGTCAGTTCGGCTACACGCGATATCTCTGGCGTAGACATCACTCCACCTAACGATCCTCCAGTTCGCTCGCACAATGAAGCTTGAAACTAAGAACTAAC
CACGTCGAAGAACAACAACAGGCATACAGCTTGAAGTGGTACTTTCCTGTCGGCTTCCGAGGGTTATATACAATGATGTGCCTTGCGTAGCGCGAACGAC
AAGCGATGCTGGCTTCGTCGACGGCTACATCCGACCCACAATCACGTGAATTGCACAACGGCGTTTCAGTATGCTGATGAGCGGTATAATTCGTGCTGCT
GGATCTCGCTTGATTTCTTCAATAGTCACTGCTGCTCGAAATGACAAGTGCTTTCGAATGTACAGGAATCGTTTCCACGGCATAATAATCGCCAGACTAG
TTGATCGGGCACCGGGTAATGCTGATGATTCCCCATCATCTCGCCAGTAATTTCGCATTTCACCTTTTTTGAAAAGCTGCATAAACCACAGAATACCCAG
AAATCTCATCATCTCATTCAGTGTAATCGGGTGACGTGATGGTTCCCCTGCACCTGATGCGTGACTGTTAGTGAACGCGACTACCTGCTTCCAGAATGAA
AGTGGTAGGAAGGCGAAAAAACTCGACGTAGCGGAGTGGCCAAATAGGGGACGACTCTCCTCACGAAGTTTGGTTGTAGTTGAACCATCGGGATGGGTAA
ACAGCCCGGGTGGCTCGGAAAGCGTTTCGGTCGTGGAAAAAGTCATCGCTTCGATTGCTTCTACTTCGGCAGGGCAAAACGGTATTTGCAGCTCGGTCTG
GCTTCGAAAAGCATACAATTCTTTGTAGCCCTTGTCAGTCATTTCTTCGAACTCTTCCGTCAAAGCAGGTATGGTGGACAAGCGGGGGGGGGCACATTAC
ATAGAGAACTCCATGAATCACCAAACTCCGCATTGTTTCTCTGCAGACTAACATACTGCTTGATCCCTTTGAAAGCCGTGGCTTCTGGAATCAGGTGAAC
ATGTTTTTTCTTGGCTTGAAACGCGGTGTTGGTCCATCGAACTTCAAACTGGGGAACCGGTACCTTGACACCATCAGCGTTTTTTTCGTGTTTCATCTCA
TATCTTGTTATTATGCCGACGAAAAAAGCCGCACCTACCTCGCGATAGTTTTTGCGAAGCATCCAGTCTTCATCAGCCGGCGAGAAAACAACGTTCGCCC
CCACAATTTTGTCAGCAGACATTTGAGCTCGCAGTAGCAACTCCTGTTTGAAGGCTGCTTCAGCCGTCTTTTTAGATGCCTTTTTGGTTGTAGCGACTTT
TGATTTCTTGGCAGCAGAGCGCTTGGGGGGATTCGATGCAGACTTTCGCTTCAATGCTCCACCTCCCGTATCCGATGATACTTTTCGCGCACTCTTCGCT
GATCGCTGCCTCGCTAGCGCTTCCCTTTCACGTTGATCACCTTGGGTACACAAACCCGCGTTTACGCAAGCCACATCATCACTATCCGACTGGATAGGTG
GAAGCCTCTCGCCAGTGTGCGTTGTCAACGTTGCCACTATACCATGACGAACCTCTTCGTGGGATGTGGAAGACAGTAGTGATGGTGGCCTCGACGTGGA
GATCGTGGTTTCGTAGCAGGCTTTACTACAATAACATTGATCTCCAAAATCCTCAATGACCTCACCGTCAGCGGTGCGAAGCGCACGTGACGATGCCACA
TCGTGAGAGCAGAAATGATGCATGAATGCGTTGCATGCATCACAACTTCGGTCAGTCGAACACCCAGTGCTGCAAACAGCACAAATCGCCACTTCAACAT
TTGTTTCACGTGTTTCAAACTCGTTGCTACTGGTACCCATCGCATCGGAGCCTTCCACCTGCCTTTTTCCTGCAGGGCAACCACTTGAAGCCGTCGACCC
CTCTTCCGCGTCAGACGAATTCCAATACCCCATTGCTCCACCACGACTAGGCCCATGCATTTCAGAACTTCTGCCGCCATCCATAGGTTCATCTATCGTG
ATGTTACCAGAGTCGATCTCGCCACCAGTCACAGTCATATTGTAGTGTTCCACCAGAACCACTTCACCCAGAACGTAATCGCCGCCCTCGACCCCGTCCG
GATTTCTACCAGGACGAACATAGCGATAGCGATTATCCAGATTCCCTCGGCCACGTGGCGGTCGTGACGTCCACCCAGCGCGACGAAGAGCCTTCCAGGC
TTCGGCAAAGGCTGTGCGACCACCAGACACTGTACAACATATTAGGTTTTGGTTCATCTAGGTGGTCAATTCAAACATTACCGGAAGTAGCGGCTTGTGA
TCTTGGCGCAATAGCTCGCCGAGGGTTCAGCGGTACAGGCGGGGAGCTCATTGCGCTAGCGAGAGATCCCCTTTTGTTGTCGATACAGAATTATATTCTT
GGGAAGACCGAAGGGCAAAGATCTTGGTAATGGTCGCGATGCGCCTCCGACGAACAACGACTGCCGCACAAAATCAAGATCCTAATCGAGAGAGGTTAGG
AGAGCGCTCATTTCCCAACCCACCAGGAAGCCGGATGGTCGATCGCCGGCGTGATGCAATCGATGTAAGTGCTAGCTAGCCACTCTCTAAGCTGATTCGA
TCTAATACTTGGTCACCCTGAACAATGCATGATAGCTCCCAGGTCCCACTCGAACAACAGCATCTAATGGCAGAGCATTGTATGGGAAACCTCGTGACGT
AAGTGCCAGTGGCGGATGATCATTATTCCACCCACGACCTGACGCGGTTTTCTAGCCACTAGCATACTTTATTTGTGGGGAGCCCGTGCTGTTTGACAGG
ATTTTTCCTGTGTTCGTTCCAGCGTCTAACCGCGTACCCATTTGAATTCAAATGACAGCAAAAGAAATTTGGGACTGACCACTAACCTATAACGAGGAAG
GTGTTTGAGACGAAGTACAACTCAACTGAGGACGTCGACGAGTTGATTGTGGCTCTTCCGGTGAAAGATATGGACAAGCTACACAAAGATATCAGCATGG
CCAAAAGTGAGAGCGCTCACAACTATCTGTGGATGCTGAGATGGCTGCAGACCTGCTTGGAGTTGTCGGAGGTAAGTACCAACAATATTCTAAGCGTTCT
GACGCTACTGTTATGTGCTTCCTAAAGATCACCGATCGATGATTCAGGATCGGATTCGTTATTTGCGGGCTCAGATTTCCGATGCTCGAGAAGCTTTGGA
CCGGCACATCGAAATCCATATTACGATGGATCAGAACAAGACGTGCGATGCCGACACGCTGTGGAAGCATACACGGCAAGGCTTCAAGCGAGAGCAGCAG
TTCAACGCAGCCCAAGATCTACTGGAGGCCATGGATGTGGTCGACATCCTGGCTCACGACCTTATGATCGGACACGGAACGCAACTTTGCCCCGGCAACG
ACTGCAACATCTATTACCGTAGTCAAGAATGGCGCCGCGAACAACCATTCCACTCACCGATGGAACTACCTCGAACGCAGTACTACTGCCGATGCCAGAG
TTTGCGTCCAGGCTGCTCACCGACTTCGATGGCCTAAGCTTGCTTGACCTCGCACTTCCACGAGTGCTCTAGCGAGACACTCACCCGTACGTAGCCCGGA
CCCTCACTGGATGAACGTTAGCAAACTGCTTTGAAATACATATCCTACTTCTTACATTATTTTCGCATCCGTTTGGTTTTCGGGTCCAACGAACACCAGA
CAACCACATCTCCTTGTTGGCCATTCATACCACACGCCGGTCGGGACACCTAGAAGTAATTGTAGCGAAAACTTAAATTATTCACACGTGTTACGCCACG
GGAAAGAAGGGCAGCCCTCAACTCGTCCATTGCGCTCCCTTCCATGCTCACCCGATGAGGCCACGACCTATTGCATTCCTCACGGAACCATCTACGTGAC
ATTGCTATCAGAATTCTGAAAGTGAATCTTGGTGTTGGTTTGTTCTTTTCTTCCACCCTCGTCCCAGGGATACAGCCTCATTCTCATCAACTAACATCAG
TAGCAATACTACCCAGGCTACTATCTGGCGTGTCGTTTGACCGGCAGATCAGGAGCAGCACTCATCTGGCGTGTCGTTTGACCGGCAGATCGCGCGGACC
GCCGCGTGTTCTAACTAAGCGTTGCTGAATTACAAGTGCTTTGGTACCCCCAGCTGAAAAGTGGATGAAAAGCAACCCAGCAATCAATGTGTACAAATCC
ATTTACGACAACTATTACAACCTGCCATGCGCGGAATAGTGGGCCAGAATCCGTGCTTGAGTTGCTTCCAACATCTACTACGCAGTTGTCTGTAAGTATT
CGCCAGTACGGACATGGTGAAGCAGATGGATGTACGCCGATTTGAAATAGCGTCAATCCAGGAGCTCGCCGACACTGCGATTTCGTACTACCCTTGCCAG
ACCAAAGCTCATGCTCTACCAGCGTCCAGTCCGCGATCGAGGGCACTGTCCGTGTCGAATCGGGTCAGGAGCACGTCGCTGACATCATGGCGCTCGTGAA
CGAATCAAACCTGACGGCCTTGTCACCAGGGGTTGACTCACAGCTTGCCTTTGCACGGTGATGTGGCCCGCTTAGCACGACCCCGGATGCTGGGTTGGGA
TGGGGACGCGTCCAATCAGCACCATCATCCCTTCCTTGTACGAGCATTGCTATGGCGACATCGCGGCGCAGTTTCCTCGTGAGCATCACGGTCCAGGACA
TCGAATCGATAAAGATCCGTCCGGCGTATCGTCACGCAGCACGGGCTTGGCATAGAGATTGTGCATATTCAGGGCCATGACGAAGGCCATTCAAGGCCAG
CGTACCAGGGGGCGGGGACTCGGTCAAATGTGTTGATTGTTGAGTGGCTAACGTGTTGACGAGAGCCTCCACAGCCCATACCGTCGAAAACAGTGCGAGT
GCGACGTCCGTTGATGTAGGTCCAGTGCGCCGACGAGGGACACGCTAGTCCAGCGTGTTGGGGCCGGGGATGGGAGGAGGAGAAGGCGGGGGATACCTTC
GCCGACGCGGG