Description :
From Genome Similarity Track
Location :
Scaffold_419:112203- 113297
Transcript NameFunction/comments
Aphin_H310_00867Hypothetical protein

Sequence
1094 bases(100 bases per row)
TGACCCAACCCAACGTGCGGCCCACGGAGCCCCAACCCAACGTGCGGCCCACGGAGCCCCAATTTCTAGTTCTTTCGTCGTCGGCACAGGGCTAGTTTTT
GCTACCCCCCGTTGGATGGCCGATGGAGGGAACCACATCGACGCCATGTCGTCCACCCCCAACCAGTCGTTACGGTTCCGCGGCTGCATCTACGAGTTCG
ATCTCAGGCCGCGATTGCTATGCCCGAAAGGGGCAGTCCCATCGCGGTTCCACGCGATACGTCTTACCCAATAATTATGTGGCGACCTCCACAGCCTAGC
AACACAATACTGGATTGAAAGTGCACGCAAGTTTGGCCATGATGCTGGAGGTCGTCGTCGATAGCATGTCCTTGACTGGGGCACTCGAATTCGAGTGCAG
GTGGACGAAGACAGCGTTTCTGAGCTAAGCATTACCGCTCAGATGGTGCTTACAAGGTCGAGTTGAAGAGTAGGATCTCGTCAGACGTGGGCATGGCTAG
GTCGGAAGACTCGCTGCTGTCAAGCAAGGCGGCGAATTCGGCCTGTGGGGATCGGAATCGATGGTTGTTTCGCCGGGCTTCGCTCACAAAGAAGTGGGCG
AGCGCTTGCGACGTCAAGATGGCGTTGTATGAGTGATCGATCGAGTTTGTCGATGGATCCTCGTCAAACTCGTACGCGTTCATTTCCGGGTGGAACTGGA
CGCCATAGAATGGAAACTCGATCGCTTCGATCGCAGCCACGTACACTTGGCCGTGTCGGTCCTCGGAAGTCGCGAGGAGCTACGCACGCCATGACAAATC
CGCTCCAGAAGCGACATCCACTTACGCGAAAGAACGAAGTGAGCGCTGGTGTCTCGTCAAAGCGGTCGGCTAAAATCCCAACCGAGTGAAAGTAGGCAGC
GATAGATTGGGTCCCCATGACGGCAAAGATCGCGCTAAACCCAAACAGGTTGCTCGTGGTTGCTGCGCGCGTGAAGCCGAGCGTGGAGCTCATGTTATTG
GCGTTGACGGCGTCCAAGATGCATGTGCTTCGTAACTCCAGCTGCACGAGCCACTCCATGCCGAGGCCTGTGCCCCAGATGGGAAAATGGGTGC