Description :
From Genome Similarity Track
Location :
Scaffold_2:1121974- 1128965
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000778sperm flagellar protein
Pytul_DAOMBR144PYU1_G000777Similar to rplM: 50S ribosomal protein L13 (Desulfitobacterium hafniense (strain Y51))
Pytul_DAOMBR144PYU1_G000776Similar to prkrip1: PRKR-interacting protein 1 homolog (Danio rerio)

Sequence
6991 bases(100 bases per row)
ATGTCGGAGCTGCTGCTCGCGTGGCTCAACCATGACCTGCAGCTCTCGACATACGTGACGGACCTGGAGCGCGACTTTGCGAGCGGCTACCTTCTCGGCG
AGATCCTCTTCCACCTGAACCAGCAGCACAACTTTGCGGATTTCATGAACAGCAACATCGCCGACGCCAAGATCATCAACTTTTGTCTGCTCGAGCCGTC
GTTGCGTAACATGGGCGTGCGGCTCGACGCGACGCTCGCCACGGCGATCATGAACGGCAAAAAGGGCGCCGCTGCGAAATTGCTCTATCAGATCAAGGTA
TCGACGTGATAGACTGTTCTGCGCGTTTCAAGAAGACTCGTGCTCATATATGTATGTGTGTGTATGGCAGATGACAGCTGAGCGGATCCGACGCGCGCCG
GAGGTGTCCACGAAATCGCTCGAGCGGAATGCGATCCTCCCGCTGCACAACATGCCAACGACGCTCGCGAAGCCCACGTACGACGCAGGCAACCACGCGT
CCTTCGAGTACTCGATCCGACGCCATGTGAAGTCGCTCGCCACGCTCAAGCGCGAAAAGTACGTAGCGTTGTCCTCCGCATTCAAATGTGGGGATGTTTC
TGCGTCATGATGACCTGTGCTTCGGCGTTTTTTTTGCTTTGTAGAGATGAAATTGCCGATGAAGAGAAAAAGCAGCATGCGTATCTCCGCGGCCAGGCAG
AGATCCGCGACCAGCTCGAGACCACCAAGGCAGAGCGGCTCCACAAGGCGTTCATCCATAGCCATTTTATCAAAGTAGCCTTAGAGGAAACGAATTCGCC
CGTGTGGCGCATCGCACTCGAGAAAAAGAACGCAAGAGAGCACCGAAAAGCGGTTTTCTATCAGCAATTGCTCGCCCATCGCGCCAAACAGCAGGTATGC
CAACGAGAATGGTGTTATGAGTGCTGAAGGATGGGTGCCGCGATGCTTGTGCGAGTCTTGACTCACTGATGTCGGCGCGGTCGTTGTATGTTCTGTAGGA
AGAGCATACATTCAGCTTACGGCAGACAGTGAAAGCTGACCTCGATGAATTTGAGGTTCGTGAATCTTCTGGGTAATTGCTTCCGCGTGTATTCAGGTGT
ATCTTATCACGGCTAATGGTGCCAACTCTGTATGGGTAGAATCGACGAGGAGGCGTAAAGTCTGCATCTAAAGATGCAAGCTTTCCATCACGAAAATCTG
CTGGCTACGGGCTCCGATCACTTAGTACGACGCTGGAAAAGGCAGACTCGAAGACCGTTGCTTCCCTCCTCTCTCCAGCATCGCGGCAGGCGACAGAGCG
GCCGATGGACAGGGCAGATTTGGTGCAGGATCTCAATTTTATACAGGAGCAAAAGCAGCAACGAAACAAACGCAAGGAACAACTGGAAAGGCGAAGAAAG
CGGTTTGTACAGGATTGCGGCAAGTACCATGTACAGCTCAGCAGTGCGCGAGCGAGTACGACGCTTGACATGCTCGTGGCGCGCGAAACAAACAGTGAAA
AAGACGCCCGGAAGGGTATCGATGACGTGCTCGTGTTCAAGGAAATTGCTCGTGAAAATCGAGAATTGCGGTGTGTAGAGTACGTTAAGCAGCGAGAAGC
TGATAGCGCAGCAGCAATCGAGCGGGACGCAAGTATCTATGGTCGGCTGCTATTGCGCTACGACGACGATGGGGAGATGCAGACCATGCAGAAGCATCAC
TTTCAAGTTGCCACTAGTGCTTCTCAGCGGCACTTGAACGAGCTCATTGCCGCGAGCATTATGCAGGATCTGGTAGATTTTACGTTGTTTGTCGCCGGGA
AGCGCGAGGAGACGCTGTATGCTCGAAGCCCGACCATTTTCGTGCCACAAGAAACGTGGACAGAGTACAAAGTGCAGTTTGCGTACGGTCACCCACTGCT
CGGTGAGGATGTTGTGCCTAGTGATGTACAGACAAACAGTGACCAACTGCTCAGCCACTTCCAATTGGATCAGTACCTGGCAAGTTTCCTCCCACTTCCG
CACATCACAATGGACTATGTCGGCTCATCTGCAAAAGGAACTGTGCTGTCACCGTGGTGTCCGCGGGATACGCTGTTCATCGGTGCTGTGGAGGTTCTCG
AAGATCGATATGTTCTTGGTGAAGAAGTGAAGTACATACGATGGATTCGCCATACCATCACATCAAGCACTGGCAGCAGTAGTGGGTCACCAGAGGCCAC
TGCAACTGAAGATCAGCCAGAGCATTCGACTTCGTCGGAGTCATCAGATAACCCAGTAATGGAGCCAACAGTTGCCAATGATGATGTTCAGCAGGATATA
CTCCCCGAACTCGAAGATGCATCAGTAGTCGAGGCAATACCACAGGTAAAATCTGCTGAGCCTCCGCCACGATTGCTTCGAATTCTGGTATTTGGGTCGT
CTTTCGCTGGAAAGAAACTCCAAGCAATGCGACTTGCAGAGAAGTATGAGCTCGCTTTGATCTCTGTGCATCAGCTCATCGAAGATGCTGTTCAGGAACA
GAGTGAGATCGGACTGGAAATTCAGCAATTGCTTTCAAGTGGCAGTGAGATTCTACCACGGATATACAGCCGGCTTGTTTTCGATGCAGTACGAACGTTG
ACGAGTTCACCAGATACGTCACCTGCGGGTGGACAGTCTGGAAGAAAAGGGTGGATCGTGTATGACCTGCCCAGTACAGAGGCGCAGGCGCGGAATTTGG
AAGAATTGCTCACAGGTTTTGTTGATCCGGAATTGATTCCGTCGCCGTTTGAGCTTGAGTCTCGCATTGCCCCAGGCTGCGTGAAGCCAAAGCTGCCATC
GACTTTCTTGCATGGAAAATCCGGTGTCGATTTGGTGTTTTACTTGGACTGCACTTGTGAAGCTGCAATGGAGAGGTGTCTGGGGCAAGTCGAAGACGAA
GCAACGCATGAAAAGTTCCATCTGGTGTACAACGAACCGTCTGAATATTCGACAGAGCGCCATCGCCTCAGTCGTACGAACCCGAGCATCAACTGTAGTG
AACTCTTGTCGCTCCAGTATGTTACAAGCGACGAATTCGCGCAATCGCAAAAGCCATGGTATAAGAAGTTCGATACATTGAGAGAAGTGTCGGCAGTAGA
CTCGAGTGTCGATGAGATCCATGAGCAAATGGTTGGCTTCGTGGATCAATTCTATAAAGACCAAGATGACATTGCTCAATCGCGACAGCAAGACCAAGAG
GATGCCGAACTAGAGCTGATGAAAATCGAGGAGCTACATCAATTGCGAATACATGAGCTAGAACATGCCATCCATGCTGCCGAGGAAGAGCATAGTCGTT
GTCAGCATGTGCTTCATCAAGCAGAAGAATCCAAAGCGAAAAAAGAAGAGCTCGCAGGACTCCGACATGCTTTGGATATAGCCCAGAAACATATCGATGC
TGCTACCAATACTGCCGTGGTATCGATTCGGCAAGAGCGGGCACGTGCGAAGAAGGATGCAGAAAAGTTTTCTGGTCGGCTACTTCCGCAACTGAGCTCG
GTGCTGGCCGGTGCGTGGGACGACATGGAGCACGAGTACGTGTCGATGATGACGAAGGTATTTGATCTGCAGCGAGAGCAGCGAACGCGTACATCAGATC
GCGCCAGTCGCATCATTGATCAATTTTGCCAGTTTCTACGGCGTCCTGATGCGAAGCAGAGCCATGTGAACCAATTTCAGGAGCTGTTCAATCAAGTGAT
CGATGAAATACGGTTTGACGAAGCCACCAAGCTCGAGTTGCATGCGCGAACCGATATCCTGCAGGACGAGCTGATGGACATTGTCGAGGCAAAAACCACA
GAGAACGAGGACGAACTGAACAGAGTCATGACGGATGGGTGGATTGAAGACACGTGCCAGTGCGTCGCAATCATTTTCCAGGTGGCGTTACAAACTGAGT
GCGACCGTTTCCTCGTCTCCGTCCAATTGCTTGTTGATGGGTTCGCTCCAGCAAGCATAATGCCGTCAAGTACTGCTGCAGCAGCGGATAACCTGAAAGC
AAATCCGGCACTGCTTGATCTGTCCTGCCGAATCTTCTTTGACGCAGCAGCCGCAACTGAAGAAGCCGCCGCTGCTGCTCCTGTCGTCGCTGCAGCTACA
CCTGCCGCCCCGGCTGGGAAAGCTGCGGCTGGGAAAGGTAAAGGCAAAGCGGCTGCTCCGGCGCCAGCAGCACTTGTACATACTCCAAGTGTACACGATC
TAGCAAAAGAAAACGACGATCCGATGTCGATGGACGAGCTTTTGGCGTCGTACGAGAAAGCGTTGCAAAAGTGTGATGCACTGGTTCGTCTCGTGCTTTC
GAAGGTTGATAACGGGAGTGCGGATCACCACAAGACGGACACTTTGAACCCTTCATCGTCGAATAAACTCGTCAATGTCCCGCCGGCAGATCCTTGCGTC
ACAAATCTAGTGAGGGGCATTCAGTACGAGCACGAGCTCATGCAGCGCCGCATCCGCTTTCTTCGAGACGCCGTGCAGTCAGCATGTGATCAAGTGTCGA
AGTCCATGCGATCCGTTGAGATGACGTTGCGGGACGTCATTGACGAGCGGAAGCAGCGGGAAAACGCTGCGACCTCGGCCTTGATCAAGTACATTCGAGC
GGCGATCGAAGCCGAAGTGAGCCTTCCGTACTTCATCAATGCCAAGGTATGTAGAAATGGGTTTGCATTGCTGACGTGTGGGAGCGCCTGCATTCTCTTA
CTCTTTTATGTCTGCCCAATTATGTATATGCGAGCAGCCTGAATTGCTGTATCGGTTCCCGATCACCATTCAGCTTCGAGACGATACGTTTGTGATCGTT
GATTCCACGACTCGTTTAGTTCTACCACCAGCAGTGGACCCGCCGCCGATCGTTGAAGAGCGACATGATGTTCTCTTGAACCCTCGTCAGGTTCAGGAAG
TCAGAAAAGTGTTAGCATCGGGCAGAACCGTGGATGGCGACGATCGTGTGCCGTTGTTTGTGTTGGTGGACATCATGACTAGTTTGAGCTCCACACCATT
GCTCCCGAGATTACTGCGAGGCTGCCCGTCTCATCTGTTCGCAAAGGTAAGTCGATAGGGAGAGAGAATTACAGGAGCGTGTTGCTTTTGGACTCATGAT
GCATGCGCATTACTGTGAAATTGTAGATTGGTAGTCGATTCATGGATCCAGCCACAGGCCTTGTCAGTGTTGACGAGTTCCTCGCTGTTTTGAGCGACAA
CGAAGCTTCCATACAACTGTTGTTGGACGAACAAGTAGCACTCGACCATGCAGATCAAGCAGAGGCAACCGAATCGAGCGATAGCGAAGCTGTAGACACA
TAGAGATCCATTAAAAAAACAGCACATGTAGGTAACAGTTTTTTGCGTGTATTTCGACTTGTTATGCGCCTCTTTTCGCCCTTCCTCTGCCGCTTGTGCA
TCGCGCGCACACACCGTTCTCACTTCTCGCCTCGTCTCTATAGAATCGTTGGGTTCTCGCCGACCTGCTCGACGAAGTCGTGGTGCTCGTCCATGAAAAT
CTTGAGCTTCTTGTCCTGCAGCGCGCGCATGCGGTTCTTCGGCAGCATGCCAAACACGGCCTTGCGCAGCACTTCCTCGGGCTTACGCTCGAAAAGCTCC
TTGGCTGAGCGCTGCTTCAAGCCGCCTGGGTGGCCCGTGTGCCAGCGATATAATTTATTGTTCCATTTGTTCCCAGTGAGCACAATATCCTTGGCGTTGA
TCACGACCACGTAGTCGCCGCAGTCGACGTTGGGTGCGAACGTGGGCTTGTGCTTGCCACGCAGGATCGGCGCGAGCTGCGAGGCCAAGCGGCCGAGCAC
CTGGCCCTTGGCGTCCACGACGTGCCACGCCACCTTGGAGGCGTTCGCGATCTTGCTCATGGCTGCTGCTGCTGATCACACACAGAGACGAGCTGCTGGC
TTCTGCTGCGCTTTGTGCTTGAGCGTTGGCACCAAAATGGGGAATCCAAACCAACCAATAATGCGTGCAGCAAACCGGTACACATACCGGTATTTTTCTG
CTGGGTGACTTTCACTACCGTCTAATTTGATGTAACCACTCGGTGGAGTAGGTCATGCCAGGATATATTAAAGCAAAGAAACTATTCGTTTAGTATTTGT
CTACCACAAAAGACATTACTTCTCTATGACACAGTCTTTCTGTGCCACACAGAATCGATTATAAGGTTTCGAGGTTCATACACTTATACAGAGCTTTTTG
GTGCTTCCTAGCAAAACAACACGAGAGCCTCGAACAAGAGAATGGGGCGCTATACGACGGTGCAGACGTTTACGGACCAGGATGCGAAGGCTGCCATCTC
GTATTCGTCCGCGACGGCAACAGCAGCAGCGAGCTCGAGCGTGAGTCACTACGGACCTAACGGCGGCGATGGCGCCACGCAGGGCGCTGGTGATGCCAGC
AGCAGCGGTGGAGACAAGCACCAGAGCGCGAAAGTGAGCATTAACCGCGTCGAAAACGTATCGGGGAGTTCTGCTGGCGCTGGAAGTGGCGACTTTCACA
TGTATCGTGCGGCGCGTCGACGGTATGTGTTCCTATGCGTCCGCGCTTTGCGTACAAAAAGGATGTGCTGAGTATTAAAACGGGATAGAATTATGTCATA
AATTGTGTGTGTTGCGTGTATTTCGGATGCAAACAGAGAGCTCGATCGTGTCGAACGCATGGAAAAAGAGTACGAGCAAAGGAAAATCAAGGAAGAGTTT
GAGAGAAAGCGGCTGCAAAACATGACCGAGTTCGAAGCGCGTGCGCACAAGCGCGCCGAGAAACGCCGTCGCCGCAAGGAGCGCACCAAAGCCAAGTCGC
TCTCGACTGGGGATGATGATAATGGAGATAGCGGGGACGAATCTAAAGAAAATGCCGATGCACCCAAGCAGAAAAAGCAGAAGGTAACAGCGGCAGATAC
ACAGCCAGAAGTGCTTCCAGAGACCCCCGGCGGCGTGCCTGAGATCCCGAACGACGGCAGCTTTCTGGAACGGATGCTCACTGAACAGAAG