Description :
From Genome Similarity Track
Location :
contig_187:11219- 12669
Transcript NameFunction/comments
g14136.t1hypothetical protein

Sequence
1450 bases(100 bases per row)
GGGAAGGAACTGGAAGGACGGATCGTGCTGTTTGAAGCGCTGGCATCGAAGTTGGATGAAATAGCAGTCGAGCACGGTGTCAATCTCGGCATCTCCTGGA
GCAAGCACTCGTGGTCGATGCAGCCAGACCTATCGTACCCAGACGTGTCGACTCATGCGTTCCGCTATGTGAAATCGCAGCGCAAAGGCATAAGGGGCTG
CTCAAGAGGCAAATCGAGGAAGCGGTCGAGAAGCTGCGTCCGATGCAACCCGAAATTGACACGTTCGTACGGGATTTCAAGACCCGTGCCGCTCGTCTGA
GCGACAGCTCAACACGCAGCTCCGTGACCTTCGCTGACGAAGAGGAGAAGGATGCTTTGGAAGACCATGGACTTGAAACGACTGCTGAAGACGAAGATAT
TGCTAGCACTGAGGCAACACCTTCGGTGGGGACGACTGACTGCGTCAGTTCAACATCGCGGAAGCGCAAACAAGCACATAAGGTAGCAGAGCTACCCGAC
ACCTTCGGTGTCTATCCCCCAGCACATCGTTCAAAGCGCACGAAGGCTCCCGCGACGACAACACCTCCCGCAACGACACACCTCCCGCGACGACACCTCC
CGCAACGACAACGCCTTCCGCAACGACGACACCTCCCGCGACGACACCTCCCGCGATGACACCTCCCGCGACGGTCGAAAGCCTACAGTTCCACTTTCCG
TGGCCGATGCACTGGCGAAGATCAAAAAAGAATTCCCCCAGTACGTTAAGATGACTGCGGAGGAGTTGGTGAATTTTCAGAATCTGCTGGTTAATGGACA
GCGTGCACCATCGGAGGAGGAGCTGCAGACGTTCAAGGCGGAGGCCGTCACGAACAGAAAGAAGGGCAAGTTCGTCAACGTTACGAAGGACGTCTTCATG
CGCATGGTGTCACTGGTATTCAGCACTAATCTACTGATCGAAATCATCGCGGACATTTCAGGAGTGGAGGTGAAGACCGTTCAAACTTACACTGGACGCC
TGCGAGTGATACTGAAGCGGGTGAACTAGCGCGTGAAGTTGAAGCTGCTAGTGTAGCAGGTAGCTGAATTAAGGGGCATGCTCTAGTCTATCTCTAAGTC
TCAACAAGAAAGTCATAACCTGCGCGTGGTGTGTCGGATATATGTCTCTCAGTGAGCGAATGCGGAAGAGCGGCGAGGCTCTATTTGTCGGCATCGTCGC
AACTACGTCCACCGACAGCGAGTGCTCCACAGCCAGCCAATCCAGTCTCGCCAGCGACGCGTCTTTCTACAGCGCGGTCGGTGACGAGAGTGGGCTGGTC
GGTGGCGCAGTGGACGGGTGGGCGGATCCACTAGGGGTGCGGTTACACACTGTGGATCCGCTCGCCCCCGTTTTGGCCCTTTCCGGACCGGAAATGGGGC
CCGAAGAGCCTCCACGTGCGGTGCCGCTGCTCGGCACCGGCGACGCTTCA