Description :
From Genome Similarity Track
Location :
scaffold_155:11213- 24552
Sequence
13339 bases(100 bases per row)
TCCAAGTTTCGCACACTACTTGAACCATTATGCTTCGCTGATGTATACTCGTTCGCTGTAAAGTTCGCTGTCTGTAACACAGGTGGATCATTTACGTTTA
TCACAGTGACAAGTAATGTTGCGGTAGCTCGAAGCCCCTCGCGATCGGTCACAACTACGTTCATAGACAATGCTGGTGCTACTTCATAGTTAATCATGGA
CGCATATGCTACCATGATAATCCCCGTATCTGCAGCGAGAGTAAATGGTGAATAGGACGTATCTTGCAAAGAGAACGTCAAGACATCATCGCTGTCTTCG
TCAGTTGCATCAACAGTGCCAATTATTGTTCCCGCGTCGCTCATCTCTGCTACAGCAAGATATGGCATTGCTTGAATTGTGGGTGCTTCGTTAATATCAA
CAATACTTATCAGAATTTCGTTGCTGCAAGTTAGAGGTGGACCAAGATCTGGACTATCACTCACTTGATAACGGAGGTGGTAAACGTTTTGCACTTCAAA
GTTAGCATAATTCTTTTGATCCGGTGCAAATTGCACAGCCCCAGTTGCGTAGTCGATGGAAAAAGTACGGCTATCTGCGTTGGATATTAATTGAAATGTG
TGTTCCTGACCAATATCCAAATCTTGTACTTCCACTTGACATGTGCCTTGGCTACCAGGTATCCCTTTGAAAACACCTGGAGAATTTTCAAGAGCCCAAC
AATGCATTAAAGGACAAATGGGCGCCTCGTTGTCGTTCACAACTGATATCTTCACTCTCGCAGAGTCTGTCAAGCCTGTTGAGTCAGTTACTAGTGCCTT
GAGCGTGAGAATTGGAGTCGTCTCTGAGTCAAGATAGCCTTGTTGAAGCAGAAAGAGTATTCCAGAGTTAGCATCAATTGCAAACAGGCTGCTTGCTACA
CTAGTAGCAGGATCGGTCACATCCCAAGCAAATTGCAGTGCATCATTCAAGTCCGGGTCGGTAGCTTGGAGCACACCCACTAGAGTCCCTCCACTTGCTA
ATTCATGAACCGCAAGATCATACTGTATAGATCCAAATATGGGCGGTTCTGGGGTATCTACCACTAGTATAGAAAAATTGAATGATGTCGAATGATCATC
CAAACTCGTAATTACAGCTCTTACTGTAAGTTTTGGCTCAACATTCGTTTTTACCAACATTTCGTAGTCAAGAGAAACTGCAGTTGTGAAAACAAAACCG
TCAGGATCAATTGCAACTGCATTTGTGATTGGTGTAGTATCTTGAAGAAAAAAATCAAATGGATCTCCTTCAGGATCCATGCCTCGAAGTTGTCCTAGCA
ACTGTCCACTTGGAGAATTTTCTGTAATTGCAATATTTAATGTTGATGCTTGAATCGGAACTGGGGGTTCATTGACATCCAGAATAAAGATGAAAACCAT
CACTGTATCAGAAAGAAAGCCTTTGCCTGTATCTGTGACGGTTAATTGTACCCGTTGCATATGTGCATCTTCGTAGTCGAAGATTGCTCGACTATATATG
AGTTTACAGCTTCGGTCACTATTTTGCACAACTCGAACAAAGGGATTTACCGTGTCATCCACAGTATAAATCAAACGTTGGTTGCTGTCTGGATCAACAG
CTTCAAATTCGTGTAGCAAAGAATCAACCTCAAGATCTTCTCTTGCTTGAAGGCACATGTGCTGGTTTTCGTCGTATCGATTTTCAGCTGTACCATCTTC
GCGAACGAAACAGTTTCGAGGTAGTTGAGAACGCTCGTTGACATCTACCACAGAGATTTCTACCAATGTCGTTATGAAGTTGAATGCCCTATCTTCGACT
GTGACGTTAAATGTGTACACCGCTTGTGTTTCATAATCTAAAGGACCTGTCACACGTAGTTGACCTGTGCTAAACTCAATCGCGAATGGCACTGGGTTAT
CTTGCTCAAACACAATCGAGAAGCCCAGAACATCGTATGCATCTGGATCGCTTGCTTCAATTGGCAAACCCACTAAGACGTAAAGTGCTGTGTTTTCTTC
AATTGCTCTTTTGGTCACACTTGCAACAATTGGTGGTTCATTCACATCTAATACATGAATTATAATAGAGCATGTTGTTGACAAGGAAGATACTAATGTA
GGTTCTGAGGAGTCATTTCTGGAAACGAAGCTGTCACCAATTCTTACGGTGACTGTAAAAGTGTTTATCGCTTCATAGTTTAGGCTCCCAGAGCGCTGTA
ATGCGATCCAATATTGATTGTCACTCTGATGAACCTCGAGTAATCCATAACTAAGTTCATTTGGGTCATTGGTCACCTCAAAAAGCGTAATCTTGTTTTT
GGTGATCGAATCCGGATCACGCCATTTAATTGGACCAAACAAGTCATTCACCGTAGCATTTTCTAAGATAGATAGTGTATCATCTTGGCACTGAGGTGCC
TCGTTGACATCTGAAATTTCCACTTGAACAGGATCAGAAACTACTTCTAAACCCGCGCGATCGGTTGCACTCACCAAAAGCACGAAAAGATCATTTGTCT
CGTAATCGAGAGCATTTAAAGTCCCTACGCGAATTTCTCCATCGCATGAGTGAATCGTGAAGATATCAACGGATGCACCCTTGCGATCTGTTGCAGATAC
AAGTTTATAGGAGACCATGTCATATTCGTCAGGATCATACGCAGCCCCAATCTGTCCCACGATAGATCCTCTTGACGCATCTTCAGCAATAATCATTGTC
GGCTGATGCGTAAATATCGGAGGCTCGTTTACGTCTACAATATCAACGCGAATTAGGGAACTTGTCTGTAGCCCATAAGCGTCTTCAGCAATAACTAGGA
GGTCATAATACAGCTTCACTTCGTAATCGACGGGCATCGCCAGCGAAATCAATCCCTCTTCTGAAATCAAAAAGAAGTCTGACGACTGCTGTGATAGCGT
CACAGAGTCGTTTTCTGGGTCCCAAAACGATATTCGAGCTTGGTTCCCGTCATGTGTACGCACCCAGTTCAGATTGCTACCCACTGATTCTGGTACCCAG
AAATGGCTAGATTGAATAACTGGAGGTTCATTGCGATTCTCTACCACTAATTGAACTGTAGCAAAACAAGCTAACCCACCGTAATCAACGGCCGCTACCT
TGAATGAAACCTTGCGTTGAATCTCAAAGTCCAATGGGATTTTCACCTGGATTTCACCAGTGTCCAAAACAGAGACAACCTCATTTCGTACTCCGTCATC
AGCCATAAAATAGCTTAGTGAACCCCACGCTACTGATGCATTTGAGTCTGGATCAACTGCAAGTGCTTGGCCAGCAACACCAATCTCATTCTCGGGAATT
GATATAGTTATTATTGGTTCGACAAATCCACATCGCTCATTCTCATTCGTCACAAGGATCGTTAGTGATTCCACAGCTTGTCTAATAGGTTTGCCATCGT
CACTAACGGTTACAACTATGATTACCTCTCGAATCGTCTCGTAATCAAATATCGTATCGTTCACAACTTGAAGTGAACCAGAGTATAATCCAACAGAAAC
TACATCATTGTCTAATCTCGTCTCCGTTGAGTTGTCCCACAAAACGAATGTGGTTTCAGTCAACGTAAAATAATGTTGTTGGTCATAGTCTTCATCAACC
ACACGAACAATGCCAATGGCAGCGTTTCGAACTGGATTTTCAGCGAGTGAAAACGCAATGGTGGAGATAATTGGAGGGTCATTTCGGTCCAAAATGATGA
TTTCTATCATTGTTGTTGCTGACAGGTTGCCGCTATCCATTGCCGTATAATAAATCAAATACTGCGATTTTCTCTCGAAATTCAGCAATTGTTTCGATAC
AACAGCACCTGATACAGGGTCTACATCAAATGTGTATGTTGTGTCAGATATTGCAAATGTCAAAATGTCATTAGCATCCTGATCTGACGCAATGTCCCTT
CCTTTAAAGGTTGCGTCAAGCGTTGGTGACACCGATACTGTGGTCGCAATCACAGCATCTTCGGGAATATAAAGGGTTTGTTGCTGCATGTGTGGAGCCT
CATTAACATCCACAATTGTTACTGACACCGTCGTGGAACCGCACAATCCACCTGAGCTGCTATCGGTTGCCGTCACTAGCAAGGTATACGCTACTTGACG
TTCAAAATCGAGGGCTTCTTGTGAGCTGACCAATATTCTGCCATCTCCAGCAAGTGACAGTATTGAAAAAGCACTTAAGTCATTACCATATGCAATACCG
TAAGTTATGGTCTTGTTTTGATACGTATCACTGTCGATCGCAATAACATCTCCAACGAATGCTTGCACTGGTGCGTTTTCCTTGATATAAAAATTGTAAT
GGTTTGCTTGAAACACTGGGGGTTCGTTGCTGTCTGTGACACTGACAATGATCTTTGCGTCACCATAGGCCCCGTTCTCATCTTGCACACGCGCTGATAA
TTTGTATAATCGCTTTGTTTCAAAGTCTAGTGAGCCTTGAAGCGTGATCACACCTAACGCTGATATCACGAACATTCCCTCTGACCCAGCTTCTGGATTC
AGTAATTCAAACGATAACACTGTACCGTCGTCTACGTCGGAAGCTGGCAAGATTCCGACAAAAGAACCTTTGTCAGCCGCCTCAGCAACTCCAAATTCAT
ACAACATTTGCGAGAAGGTGGGGGGCTCATTCACGTCAGTTATTACTAAAATCACGGCAATGGTATCTGCCCGAGGTAATGCTGAGGTATTCGCATTGTA
AATTTTCGTGACAGGGAGCACAACATAGATCACACATGTCGGAATTGTTTCGTAATCCAATTTTCCAGTTATGAGGCTAATTTGCCCCCATGAGTTGACA
GAAAATGATGCACGGCGATCACACGTACTGTTTACGACATTCATTTCAGGAGAATATCCTACGACAATATTCAAACTTTCTTCGTCGACAACAAAACGAG
ACAGCGGGGATCCGATGTTACTCCCAGCCTGAATAGATTCCTCTACTGTGAACGAAATGACTTCCTGTACGAAGTATGGTGGCTCAAACACATTTACAAG
GTTAATCGTATACCGCATTCTTGCAGTCAAGTTGCCTTTGTCTTGAACACACACATCTATCCAAAGTGAAGGGGTTCTTTCAAAATTCAGCACCGTTGAG
TTTTGAACGACAATTTCTGCGTTGTGCAGCCCAATCTGTTGAATACGAAAGGCATTAGCGTCACTTTGTTCACAAACCCAAAATTGATGATGCTCGTCTA
TGTCGGGATCTTGGACCAAGATACGAGTTACAACAACCTCTTCTGGGGAATTCTCTTCTAAGAGTGTTGGTACGGAAATGCTTAGAGCCGGCGGCTCATT
GACGTCGATAATATAAACTAAACCTTTTGTAGACACAGTGAACTCACCATCTGAAACTCGTACAATGACAGACAAAGTGCTTCCTGCTGAGGACTCGTAG
TCAAACGAGCAATCCGATTTCAGTAGGAGTTGTCCACTCATGCTATCAATTCTGACACAGGCCGTTATAAGCGCACTAGTGCCTCCAAGATCGTATTTAA
GTACGGATTCTGTATCTGGGTCAATCGCCAGAATTGGATCTCCAACAGCAGATCCTGGTGTTAAATTCTCTGGCACGAAAATGTCGAATACACTAATAGC
AGGTGGTTCATTGACGTCAATTACCGTGATAGTGAAGTCTGCTTCATCAAACAATCCACTGTGGTCTGTCACACGAACACGCAAATTGTAGGTGGACACT
GTTTCAAAGTCGAGAGGCGTCGAAGTTGTCACTTGACCGGATTTCGAGTCGATTAAGAAGGTAGATTGGTTATCATACAACAGTGTAAAAGTAAGCACAT
CGTGCCCATTTTTCATGTCAGGATCTGAGGAAAATGTAGAACAGGCTTGCCCGACAAGAGTACCAACATTTGCATCTTCACGAACGCTTACAGAATGACC
CCGAATGTTGGGAGCTTCATTGATGTCACCAATAGTTACAGTGACATTGGAAATAGAAAACAGTCCAGCGTTATCTTGTACCTTTACAGCCAAAACATAC
TCATTTGTTTCTTCGTAGTCTAGGTTGGCCGTTTGCTGAAATAAAACACCAGTTGTCGTATCAATTCCAAATGTAATTGGAGCTCGTGCAACAGCGGCTT
TTGGAGTCTCTGACTCTATACTGAAGGAAAGTGTATTTCCGTCACTGTCGGAAGCATGAATAGCAGGCAGAAGTTTGGTCAAAGGAGGTTGATTTTCCAA
AATTGAAAGCTGCATGGGTTCGATAGTCGGTGCTTCGTTGATATCGTTGATCATAATGTTTATGTTTTGAATTTTGCTTTTCGCTCCAGATCCGTCTATC
GCCACAACCGGAATAAAATAGGAAGATTTTGTTTCAAAATCTAGCCCATCAAACACTAACTGGATTATATTGTTCACAACGTCAAACATATCGATCTCGC
CGACGACGCTCGCGATACCACGGTCGGATTGCCCATTTTGGACTATATCAGGGTCAAATATTGTTAAGTTTCCCATTGCCGTTGTACCCGCGAGTGAGTT
TTCGTCGATGTAAAACGTAGTTGCGAGTATCTGCGGTCTTTCGTTAATGTCCCTAACCAAAATCTCGATCAGCTGTTGAGGGCTAGACAGGCCTCCGAAA
TCTATTGCTTTGATCAACAAACGCCATATTTTTTGTTCTTCGTAGTTGATTTGTCCTGGATTCTTCACCACGATCTGGCCTTCAGTACTAATGTTAAACG
GGCAGTTAAAGTCGGCTTGTACAATCTGCCAGAAGTGATTCTTCCATGAGCCATTTGTTGCACCAGTAGAATCTTCGTCCAGAACCGTGAGATTACACAC
AGTCGCACCAACAAATTGACCCAGTTGTTGATCATCCAAATCGTACGCGTACTCGTCCATCTCACATGCCTGTGGCGAAATTGCCGTAGGTGCGTCATTC
ACATCGATAATATTAACTGTAACAATGTTGCAATCGTTTAAGGGTGGATTTCCTCCATCTCTCGCGCAGACAGTGACAACGAACTGGGGGTTAATTTCAT
AGTTGAGAGAGGTTGAATTTGCCACGAGTAATATCCCAGAAATTGGGTCGATATGAAAGACAGTAGACTGAATATCAAGAGAATCAGCGATGTAGTACAC
CAAAGTTCCCGCTGCTAATTCGGAACTGTCAGGATCGGAAGCTCTGACAGCGCAAATTGGTGTTCCAACAGAAGTATTTTCTTCCACATAACATATTTCA
CCGTTTACAACGGGGTCTTCGTTCACATCTGTGATATCAATGTTAACTACTGACACGGTAGATAGTCCCAGCTTGTCCGTTACAGAGATCAAAAGTTCAT
AGCTGTTCTGTACCTCATAGTCCAGTAGATCAATATTAGCACTGATCTCGCCAGTGATTTTGTCCACAAAAAATACAGGATGCTGAGAACCACTTTGTAT
CATTCCAAACTCTGCGTTGTCCTGAGCGTCTGGATCAGAATATGGGACTATGCCATCAGTAAGGATCACTCGAGAGACTTTGTGTTGTGCATGTGCAAAA
GACAATGTTAGTGATATCATTGCACATGCATATTACGACAATAAATCTTACCTTGGGCTACAGTGACTTCAAGAACGGCAGCATTCGTAGCACCGCGATC
AAAGGCGTTCACCTCGCCTATTCCCCCTCCCGTGATAAGCAATGTTATAGTGCTAGTGTTCAAAATATCCGTCATTATCATGTCGAGGATCGTCGCAATG
GATGGTGACCAAATAATCGAAGCGGTCACTTCCTTTTCAACGGTCCATGAAATAAATGCTGGTCTGCCATAGCTTTCCAATGGTTGACTACTATCCCACG
AAGTACTAGGATCGCTAATTACACGAATTTGGAGAGAAAACGGACCAATTTTTCCAGACGGAACCGTGAGGCGCAATCGTGCCAGCGAGATGCGATCTAT
CACTTCGGGAAGCTGGATACCATCAAACCGGAATACCACTCCAATTGAGCTCTGGCTTAAAGAATCGTACCCCAACGGAAGCGTCTTACTAGAAGCGTTT
ATCGAATATCTTCCAGTGGCCGTCTTTCGGACAGTATAGTCAGATTGAGGTGAAAGAATGGGAAACGTAAACATTTCAGTCGGTAGAACGCGCGATGGAT
TAGAATTAGTACCTATGCATGACAAATGTTAAAAGTTGTGAGAAACCATACAGGAAGCAAACGTTGCTATGCTCATACCTTCTGAGGTGGTGAGAGATAG
ATTCATCGTCATGGGCATCTCGTTGACATCTCTCGCTGCTACGAATATTATGCAACTTGTACTCAGCGTACCAAGCCCATTGTGGTATGCACCGTCATCG
GTCACTACTACACTAGCTGTCGTTGAATTAAGTGTGTCCGACTCAAAGTCGAGGTTAAGTTCGCAACTCACAGATAATTGACCAGTACTCGGATGTACCG
TAAGGAATGGATGTTGCAACGAGAAGGCGAAAGTTGTTCCAGTATCAGTATCTGTCACATAGGAAGATAACGGCAAGCCAACAAGAGTACCAATTGCAGC
ATTTTCATCCATGTAGACTGAGAAGCCCGATTGGCAGAATGGCGGTGCGTTATCTGCTACCACATTAACAGTAATTGTGGTAACTGCTGCGAGTTGCATC
AAATCGGTCACTTTCACCGTTAGAATAAAGATATAACCTGCTTGGAGTAGCTGAACGCTTTCTGTGGAGTCCACGTTCAGTTCACCAGTTTGTTGATTAA
CAGCAAATACTACAACGCCGTCTCTGGTGTTGGCTGTGAGTTTAGTTGTCGAGGATAAAAGAGAGAATGACAATACGTCCCCATAATCCGGATCAGCAGC
CTGCAACACGCCTATCACAGTTCCTGAAGTAGCATGACTAGCCACTGAAAAATTAAGATATGTATTGGTTTGGAGAAAAAAAGATGGAGGCTCGTTGCAG
TCCTCAACCGTTATTCGGAGAAGTGTATTTGTGCACATCGCATAGGGATCACAAGCTTGCAGTGTCATCTCGTATCGTGACAAAACTTCATAGTTTAATA
AGACTTCCAAAGTAATGTCAGGGCTGCCTGTGTCACGGAAACTGATAACACCAGCGTACACATCATTTAGAACGTGGTATAGTAATTTCTGGCCGAAGTC
TTCCTCCTGAACCTTCCACGACAGCACAATAGTTCCAATGGTTGCATTTTCCGGAACTGATACATATATCATGCTAGTACTCGTGGGAGCCTCGTTAACA
TCTTGAATATCAATTACTACATGTCCAGTCGAACTAAGCGGGGGGGCTCCATTATCCGTCACACGCACGTTGATCCATGCTCGATGAAGTTCTACAGTCT
CAAAATCCAGGCGTTTTGGATCAACAGCCTTGATTAACCCGCTTCCAGGATCTATAGAGAGCATTCCAGAAAGAGATTGATCAATTATTTCGTACACAAG
ATTACCCGTCTGATTAAAGTCAGGGTCATAAGCCTGAACGTTGTAGAATGAACCATTCGTGCCTTCTTTCACTTCAATGCTTTGGCTAAAAATTACTGGG
GGTTCATTAACATCGGTAACGTAGATGGTAAGGTTGCACGTACTGCAATCACCTGTAATATCGCATGCAGAATATTGGAATTGATACATATCTAGTGCCT
CGTAGTCCAGAAACAGGCCTTGCAGAGCAATGGACGCATTTTTAAACTGAAAGCCACTAACTCCTTCATTGTCGATGAGAGAAAGGATAGGATATAAGCC
CAGATCTTTCGCATCTGCATCGATACTTTCAATTGGGGGAGTTAGAACTGTCCCAATCGGACTATTTTCACTTACAAATCGTGTTTGGGACTGGCAAGAT
GGCGGTTCGTTAACATCAAGGATATTTATAAGCGCGGATGCGCAGGTTTCCAACAGACCATCGGTAGCACAAACTTGAAATCTATATGAAGTCCGCGTTT
CGTAGTCTAGCACAGCAGTGGAGGACACCAATATTTCACTCGTCATTGAATCGATGTAAAAAAAGTTGATGTCATCAGTAGATTTGATGGAGTAAACCAA
TCGGTTATTTTCCGGATCAGAAGCTGTAACCATGCTTACCACCGTATCACTCTTTGCATTTTCATCAACTGCTAGCATGTACTGAGTTTGAGCAAGCACT
GGTGGTTCGTTTACGTCAAGAACGTCAATTGAAACAGGAACACGTAGTCGAGCTTTGCTAGAATCGTAAACAGATACTGACAGGGTAATTTTTCTTGGCA
TCGTTTCAAAATCCAGAGGTTGGTTGGATCGTAACTGTCCTGTACAACCATCCAAAGTAAAATATGATGAGAATTCAGAAGCGTCTAATGTGTAACTAAG
CGTATTATTCTCAGGGTCCCAAACATAAGAGGACAGAGAAACGCCAACCAGTGAGTCCTTTATCATATTTTCTACGGCTGCAGTTTCAATTTTAGTCCCC
GTATCCAATTCAGGTGGTTCGTTTAGGTCTTCTATCACAATATATACCGTAGAGTTCACGTTCAAAGTAGTTTCACGCTTTGCAATATTAATCGTCAAAT
TTATTGAGTGACGGAATTCGTAATCCAGCGGTTTGAGTAGAATCAGTTCTCCGGTAATTTCGTCAAGTGCAAATTCGTAAATATTTTCCATGAGTGAAAA
CGTCAACTCCTCTTGAGATAGTCTGTCTGGGTCAGTAGCATTAACGAGAAGTAGAGACCGAGGAACCGCTCCATTCTCTGGCACAATTACATTGTAATAC
AAGGGCACATGAGGAGCCTCCTCTTCATTCAGTACTGATACGTAGACCACAGATTGTGCTGTCAGAAAACCAGCATCCGTCACTTCAACCTGAACAGTGA
GTTCAGAGTCTGTTTCAAAGTCAAGCACTCCCGGTACGAGTATAGAAACCTCTCCAGTCGTGGAGTTTACTGCGAAATCACTACAATTAAGCAAGCTAAA
TCGAAAAGAAGACCAGGTTGGATTTGTGTCAGGGTCGGTCGCTTGGATTATCATAACCGAGTCCCCTTTTGCTCCATTCTCGCTGATATAACCACGTTGT
CCTGAAACAATCACCGGTACTTCATTCATATCCGTGAGTTGAATAGAAATGGTAGTGTACATCGACCGTGGTAATGGTGCGTCATCCGTCACTACTATAA
CGCAGGAAATGACTGCGTTAGTCTCAAAATCAAATTCGGTTGTGTTCTGCACAACCAGTTGGTTTGACAGTCGATCAATTGAAAATGGACACCTAGTGCC
AACAATTTCAGCACCCAAATTTTCTGTCACTTCTACCGACTTCGTGACAAATTTGCCAATTATGGAACCTTTGTTAGGATTTTCAACCAATTCGAAAATT
GTTGACATCGCTGTTGGAGCGTCATTTGCATCAACTACATCAAGTTTTGCTATGATGCTGTCACTGAGACCCATTTCGTCGTAGACATCAGCAGTGAACC
ACAATGATTGTTGCATTTCAAAATCAATCCATCGTCTCCGCACAGAAAGAGACCCCGACGTAGGGTCGATTTGAACACCAGCTGGTCGATCCGATTCACG
AAGGCGAAAATAAATACTTTGCTTCATGTCTTCGTCGACTGCGTTTAGTGGATCAGATACTTGGAAATCTGTCAATACAAAATAATCCGAGTTAGGAGTA
TAGCTCATCATGCAACATAACGAACAATTACCTGAGTCAGGACCGTATAGCTCGAGCCGCAAGCACGTACTACCAGTCCAACTCGTTGGAATAATTCGTA
TATCCGTGGCAATTACATTGGGAATAACAATCGTAGCCTTGGTTGGGTTTCCCTCTCCAGCGTTTAGGGCAGCAAAAATTATGGTCGCATCAAAGTTATC
TGAAAGAATTGAAAACTCTTCAGATCTTGAACGCCGCCAGGATATCTGAAACGCTTCCAGATAACCTGCATTTCCATTCATATCGATGCCCGGATATATT
TCAACTCGGGATACTACTGTTGCTTTTGGAAAATTGACTTGAACCCACTCAGTGGGCGATGCAGATCCTGGGCACCAAGAACCGTTGACGTTGTCACTGC
GGATGACACTTAGCCCCTCATATCCGTAGCCGTGAGTTTTGGTGTTATACAGAAAACTGCTTGCTGTCAATGCATCTGTCTTGAGGATTGGTCGGGATAA
CTCACCAATAAGTTTGCTATCAGCATCTATTTGGAACAAAAACGTACGAGTTCACAATATTAGCACGCAGCAATTTAGTATCGAATATTAACGTACATTT
TGAACAACACGCAAGTTGGGCATTGCCTGCGTTTTGCTCCGCCCTCATCACTTTGTTGAAACAAGCGCGTGCCAACATCGGTCCCTGGCTGGCTGAAGGA
AATATTGTAGGACTGTACTGCGGGTCAACACATAGCGATTCAAAATCCATCCTGTCACAGAGACGTAACCCCTTGCTAGCACAGTATTTGAATCCCTCGT
CTTGGGAAACGGGGTCAACGCGTGAATCTGTTACAACAAAGAAACTTGGTACTGCAAACAACGATAAATTAAATTAGACTAGAACTCGCCTCCATGTTGC
AGAGCTTGTTTCGTACCTGAGTATGCAGCAAGTTCATTCATCTGAGTCGTAGATATTGCACCAGCAAAGTAATGAAATCTAGAAATCCATCCCTTGAATA
AATCGGGGTATGACGATAGAATTGCGTGCTCAGCGAGAACTGGTGGACCAAGTAGCATTAACGAGGCAGTGTCAAGATTTCCATCGATATATATCCTAAC
CGTAAGGTCGTTGATAGTATAAATGATAGCAATGTAATGCCATGTGTCATCCGATACGACTTGGTTGCTTTCGACAGATGAAGAATGGGTCGAAACTTTT
AAACTCCCGCCGCTTCCTATGGATACTTCAAAGTAATCGTTATTTGTAGATCCCTGTAGACGTAAAATATTTCTTCCAGCAGTCTTCGTGCGTACGCTCA
AAGCCGCGCTGAAGTCTAGTTCACCAAATACAAAGCTAAATCTTCGGTCGTTTAGTAGATCGTGAGAATTATTGCCAAAAAATAATCCTGCGTTGGTCAT
ATAATGAAGGTTTCCAGTAACGCCGTCGTCGAACTCAGCTGCCTCTGTAATTTTTCGAGCGTTTCCAGCAAAAGAATCAAATTTGGGAGCTTCATTGACA
TCAACAACAAATATGGTAAAGTTTCCACATCCCTTCATTACTGCAACGTAATCATTCCTCGCTCCGTCGTCCATTGCGCACAGTACGAAGGTGATAAAGG
GTTCAGTTTCAAAATCTAGTGCAGGTGCCCACACATACACATCCGACGTATTTTTATTTACAGCATGAAAGCGAATTCGATCAGTTTCAGGAACTGTGAA
AAATGATAGAACACTTCCGTCGTAAGAATCAATACCCCA