Description :
From Genome Similarity Track
Location :
Scaffold_147:112124- 114457
Transcript NameFunction/comments
g4595.t1hypothetical protein

Sequence
2333 bases(100 bases per row)
CTACCACGGTAAACCTCGCCGAGTATGCTGGAATGAACAACGGCGTCTCGGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTTGGAGATTCGAG
ACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTACAACTGAATCGTCACCGAGAGCTCACGACCAAGCTGCGGTCA
GTGAAGTATTTGCACGTGGTCCGAGAGTTCAACGCTGCGGCAGATTCGTTGGCAGGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCCTCGACCGAGG
CTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGC
CCGAGCCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGAAACCAAGCA
AAAGTGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGTGCAGCTGAGCGAGACGAAGCGAATGATGTGACCACCGAAG
CTCAGAGCGAGCTGGGAGCCGAGCAATCGAGCAACGAGGCGGACCCTGGCGCTCCGAACGCAGAAGATGTTGACCCTGTGGTTATACAAGAAGAGCGCCG
GAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCCAGA
GACGCTTGGAAGATGGCCGATAAGTTCGTGCTTAGCGAGGATGGTGTACTGTGTTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAAA
CAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAAGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTA
CCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCA
CAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCTACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCA
ACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACTACCGCTCTGAGGGTCGCACAGGCTTTCGAGGA
ATGCGTGTACCGAAGATTCGGAGCACCAACTCTAATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAG
TCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAG
ACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGT
TCATGGGTGGGACGCACAAACCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTG
AACCGGCAACAGGAGATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGAGCTAGAGAACACAATGAGTCGCTGGAACGGCGCG
AGAGAGCTGCAGTACCGAATGTTGATGAAACCGAGACTTCTGACGAGTCACAGGCGGAGACAGGAGCAACATCTGATCCCACTGTCGAAGGACCGAGGTC
TCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAAGAAACTCGCTCACCGATGGCATGGGCCATTCAGGATC
AAGAAAAAGATCGAAGAGTTCGCGTACGAGTTGGAATTGCCAACCGGAGTGGGTATAGATTCTACCCGGTGGTACACGTGTCCCGACTCAAAGCCGTTAA
CGAATTCGGAGACCGACCGAAGAGTCGGTTGGCGCCTGAAGTAACCGAGGATACGAGACTGGACTTCGACGAGGAGTTGTTGCCTGAAGATAGCTGGGAG
CCAGACCAGCTCGCTGGCGAATACGAAGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTCGACGAGCACTAGCCGTGCTGTCCGAGAGTTCAAGGTGA
AGTGGATTGGGTATGATGAGCCCACGTGGGAGC