Description :
From Genome Similarity Track
Location :
Scaffold_107:112114- 113766
Sequence
1652 bases(100 bases per row)
GAAATTCTACTCCAAAATTGAAATGCGGAACGGGATGGAGTACCCACTGTAAATGCTTTTGATAGGCGAGCTCCAGAGCTTTCTCCTCAATGTTTTACAA
AAATGACGGTTAAAATAAGGAGCAAGCTCTGGAGCTCACCTTTTGATGTAAGTTTTTTTTTCATTCAGTCCATAGAACTGAATCAAATTCGGTATGTTTA
CGTACCCATTTGGGGGTTGGCGGGAAGGGAATGGGTTGTAAAGTGTGTTTGTCAATATGGGTGCTGATAGATTGCGTGTAGTAAAGCTACTCAAAATGTT
GTTGATTTTCTAAACCTGAGGAATATGTAAAAACGGGGAAGACCCCTGTTCGGCAATACCATAAACAGCAAAGTGTGACCTAAAATACATAATAAACTAT
TGATAAAGAGAAACCAGATGGAGAGAACTTGATCTGCTACCGGAAGAAAAATAAATCCATAAACGCTTACCAGTTCAATTAATTCAAATCAAAAGCACTT
CACACTTACTGTTGCGAAAGTTGCATGACTTTCGCTGCCCCCAAGTCTCTAGTATTTGCTTGAAATCTCTCTGTCCAAGGTACACCTAGCTTTATGTACA
CACACAGACACACATACAGAAAGTTATGCTTTGAAAGTTCAAAATTCACCCTGCAAACAGTCATTAATAACTTTACCCTTGGGGCTTGCAGTAAGTGGAT
GCAAACATCCTTGTGACAAATGTACTGGTTGTACCAACCGTCGTATGACCCCGTAACACAAAGGGCAATGCGTTGACATATACGAGCCTTTTTACGTTCA
GCATTTACGTGGAGTCCAACTGACAAGCTATGTATCACATTCATTGCAGCTAGCTCATGGTTTGTTGTACCGTGCTCAGATTGCCAATTCATGTTCTGGG
TAAAGCTGCGCAGTCTGCTGCTCTTTAAGGTGATGGTTGTAAATTGCCAGCGTACTACAGTCAGCTAAAAGAAGCTAGCTACATTGTGCAATGGTACAAT
AATGAAATAGCTGTTTAAGCCGATTGGCAAAAAGGTAATTGTACATTGCAAGCGTTACCAGGCCCTCCATCAAACGGAATGTGAGGGTAAAAGGTTGCGG
TGGGGTCTGAAACACCCATTAGTCTTTGCAGGATCAGCGCCATAGAGCATTATTCAGACACAAGATCCGCGGGCACGTCACTGATGGATGTGACAGCGGT
CTACAGAGCTACCTACACTCAGGTAGTGCGTAGTAGAAATAAAAGCTTCCATGACGCCCGATCTGAAATTGTTCGAACGTTAACGAAGATCAGCACATAC
GCATTACTCAATTTTATTGATCGTGACTACCGTTACTGGTGACTACGAAACTTCGTGAAGATCTGTATTCTAAACGTTGCTGCCGGTATGCATCATTGCG
ACAAGAAGGTGGATCAAGTCCTGAAAGTTTACCCAAGCTTGCACGAACTAGACATGCAAAACGACGATTTTTGAATATTATCGTTGGAACAGAGTCCCTG
TCGCATCATGCTAGCACATAAATGCCGCAATGTAAGTTACTTCTAGAGACACCGCTGGTAATACGCTGCTCAATTCGAAGATGGAGCCGAAAGTTGACAT
TATACAAAAAGCTGGATTATTCGTTACTACAGGATACCTAAAGCTGTCAAGT