Description :
From Genome Similarity Track
Location :
contig_187:11210- 12214
Transcript NameFunction/comments
g14136.t1hypothetical protein

Sequence
1004 bases(100 bases per row)
ACCAAGATAGGGAAGGAACTGGAAGGACGGATCGTGCTGTTTGAAGCGCTGGCATCGAAGTTGGATGAAATAGCAGTCGAGCACGGTGTCAATCTCGGCA
TCTCCTGGAGCAAGCACTCGTGGTCGATGCAGCCAGACCTATCGTACCCAGACGTGTCGACTCATGCGTTCCGCTATGTGAAATCGCAGCGCAAAGGCAT
AAGGGGCTGCTCAAGAGGCAAATCGAGGAAGCGGTCGAGAAGCTGCGTCCGATGCAACCCGAAATTGACACGTTCGTACGGGATTTCAAGACCCGTGCCG
CTCGTCTGAGCGACAGCTCAACACGCAGCTCCGTGACCTTCGCTGACGAAGAGGAGAAGGATGCTTTGGAAGACCATGGACTTGAAACGACTGCTGAAGA
CGAAGATATTGCTAGCACTGAGGCAACACCTTCGGTGGGGACGACTGACTGCGTCAGTTCAACATCGCGGAAGCGCAAACAAGCACATAAGGTAGCAGAG
CTACCCGACACCTTCGGTGTCTATCCCCCAGCACATCGTTCAAAGCGCACGAAGGCTCCCGCGACGACAACACCTCCCGCAACGACACACCTCCCGCGAC
GACACCTCCCGCAACGACAACGCCTTCCGCAACGACGACACCTCCCGCGACGACACCTCCCGCGATGACACCTCCCGCGACGGTCGAAAGCCTACAGTTC
CACTTTCCGTGGCCGATGCACTGGCGAAGATCAAAAAAGAATTCCCCCAGTACGTTAAGATGACTGCGGAGGAGTTGGTGAATTTTCAGAATCTGCTGGT
TAATGGACAGCGTGCACCATCGGAGGAGGAGCTGCAGACGTTCAAGGCGGAGGCCGTCACGAACAGAAAGAAGGGCAAGTTCGTCAACGTTACGAAGGAC
GTCTTCATGCGCATGGTGTCACTGGTATTCAGCACTAATCTACTGATCGAAATCATCGCGGACATTTCAGGAGTGGAGGTGAAGACCGTTCAAACTTACA
CTGG