Description :
From Genome Similarity Track
Location :
Scaffold_15:112069- 115741
Sequence
3672 bases(100 bases per row)
TGGATCAGCAAGGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACT
GGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGAAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACA
ATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAAGGATGG
GGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAAACGGTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCA
GACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAGGTATCGCCAAAAAGCTCCGACGC
TCACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCTGACTCAGGAACTGAATCGGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCG
GGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGA
GATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCACAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTG
GCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAATGCCCGATGGAAGAATTCTACAACCA
GATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTAC
GAGCCGAGCGTTATAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCT
ACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAAAGGTA
TGTGGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCC
GTGGATCTGAGGATGTTGGATCCATGGATCTGCTGACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGT
AGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAA
GTGGATGGGAGTCGGATCGAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTCGCTTGC
TATATTGGTTCGATATTTGGGTTGGAGACCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGTGAGGTTGGATCTGGCAGA
TGGGACACTGTGTTTCCCCGACAAGATGCGGATCCAGCTCAGGTGGGGTACCTACCTAGAGGTAGGACCCCAGGCGTAGTGACCGCGAAGTGCAATCACA
ACAGCTAGGGGGACGGCGACCGTTGTACGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCA
GATCGGTTGAAGTAGGTGGAACATGAGAAACGGTGGGTCACTCGGGGTGAGAAGTGGGTGCCTACAGTAATCCAAGGACCAGGTCGGTCACAATACCTCC
AGGTCACGAGCGGCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCCAGGCGACCTGGACATGT
GTCAGTGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGGGAGGGGGAGCTCCCGGTGGAGCCA
ACTGGCCCCTTGGTGGATCGGCCTTCATACCCAACTCCGCGAAAGATCCTGCAGAGGGATCGTCGGATTGAGATCCAAGCGATAGAGGTGGGATCCAAGA
CAGGAGATGATCCCCCGAGCAAGCCCCTAGATAACTCAGGGTCGGTGGATGAAGGATCGCAGAGAGCTGAAGCCGAGTCGCCAGATCCCGCTGACCCCAG
AGTGAATCCTAGCTTTTCATGGGACAAAGTGCCTGGATCCTTATCGAGAATGGCAACACTAGTCAAACAAGAACCGTCGTGTTTAAACTCGTTAGTTGAT
CAAGTCTATCCAACTGGTGGCTTCCCCGGTACCAGGGTACCGGATCCCACGAAGGCAGAAGGACTGACATGTGAAAAGGGGTCGCGGTGCTTGGATCCAA
TGGTAGATCCAATGAAGACGGAAGATGAACAAGTCGGTTACCATGAAGGCGGGGATCTACACGCCGAGGATCTCGGAGAAGGCCTGGCGGTGATCCCGGA
GGTACCACTGACCACAGAGGAGGTCACGATTGACGATATCCAAGTGGATCCAGGGGCGAACGAGCCCGCGGAAGTGGATCAGTTACGTCGGATCTGGGAA
AGCCGGCATCTGCTGATTGGCAAAGGGAATGCATTACCACCAGCTGCACGCGTAGTCAAATGTGACATCGATGTTGGTGACCCGAAGCCGATCGCTCAAA
GGGTGCGGAAGGTGGCGCCTCAGTTCCGAGAAAAGCTATCGGATCTGATTAAGGGTCTGCTGCAAGCCAAAATCATCAATTTCTCAACGTCTCCGTGGGC
GTCTCCTGTGGTGATCATCGTTAAGAAGAACGGAGTTGATATACGTTTGTGTACTGATCACCGGATGGTTAATGGTCTGACCAGATTGATGGTGTATCCG
ATGCCGCTAATCAATGAGCTACTGGAGGATTTGGAAACGGTACTCTGATATTGTTCTCTAGATATGGCAAGTGGATTTTGGGTGGTGACTATGATGGATC
GAGCTCGCGCAATATCCGCATTCGTCACACCATTCGGACTGTTCGAATGGAGCCGGATGCCGTTTGGATTGAAGAATGCACCTCAGATCTATAAGCGCCT
GATCGATAATGCCCTCTACGGATTTTCCCGAATACCGGAACCCGAAAGGGATGGATCCGGAGAAGGTCGTGTGGAAGTGGATCCATTCGAAGCATGAGAG
CTAGGTGATCTGGCAACCCCATCCGGGTTAGGCGCAGATCCTATATCGACGACATTCTAATCCCGGCAGAATCAGCTGTGCGAGAGAGTAACATTCCTAC
TGGAGGCATGTACTAAGTGGAATATCTCTATCAGCGTGGTGAAGGATTATTGGGGGATGGGCAAGGTGGATTACTTAGGCCATCAAGTCTCCAAGGAGGG
ATTGGAGGCGAATCCTAAGAACCTGTCTTCGTTGGCACACTTGTCCTTCCCAAAGTCGTTACGGGCGATGCA