Description :
From Genome Similarity Track
Location :
contig_6:112056- 116751
Transcript NameFunction/comments
g2061.t1hypothetical protein

Sequence
4695 bases(100 bases per row)
GCGGTGGAGCTAGCGACATCATGTCGTAGCGGTCGTCCACCATGCTGTGCAGTAGCACGTATCGCTCCCGTCCGACACCGCGTGAGTTGTTGTTGGCCTC
GGGCGTGAGAGAAAGCACCTCTTCCATTGTGTACTTGAGCTGCTTCCGATACCGTGGGTTGTTGGCGCAAACGAGTCGATCGCAGCGCGTCCCTCTTCCA
TCAATGCCGACGACATCTCCCGCACCAGCGCAAACGGCAGGTCCACCGAGAGCACCTTCATGGCCTCGTCCCCGCGAGACGAAAAGCTGGACGAGATCCA
CTTGGACACGCGACGCGTGACCTTCTGTGTGTCGAGCTGGTAGTTCCGGTAGTTCCTATCCCTCGACTGGTACTTGGCATCGACCACCCGACGTCGAAGA
TGGGCTGCAACGAGCTGCTACCTGACGACGAATTGCCGCCGCCACCACCGCTGTTGTTGCTGTTCATACCATCGCCAAATGGTTATTGCCACGGCCACCA
CTAGCAGCAGCGTCACCATGCGAGGTCTTGCCAGACGTTGTCAGCAGCTCGCTGATGTACTCGGGCAGCGACGTCACATTCGTCACCACATCCGCTTCCG
AGTGGCTTTTCACAGCTCGAATCTTCACTGCTGCTTCTCTTTCATCATGTGCTTCTGTACGATTACCATCCACTGCACATTCTGCTGCGCGCAGTAGTCT
TCGAGGTCCTCCAGGTGCAGCGGCTCTGGATGCAGGTAATCTGCGCCGATGCCCTGTCCCACAGCAGCATCGCGATCTGCATCCGGAACAGCATCGTGTC
CGACGCCTTGCCAGCCGAGCAAATCAAGACCTTGCGGCCGCCCGTCAGCACCTCCGACGCTGGTGGTTTGGATTCCAGCAGCGCTGAGCTCATGGATTCA
GCGACCAGCGACACGATCTTATCGATAGCGAAGCGCACGCCCATTGCAGCGACCGACGAGGCTTTTGCGTATGCTGTTGTGAGCTTGAAGCGCGACACCA
GCGCATCGTAGCGTCCACCCTCCGCGATGATGATCTGGTTGTCGGTCGTCGCGACCAGCAATGAGGCTGATGTATCACCAGTGGTGCCGCCATACGCGGC
CTCCCCGAGCAAAATTGCCTGGAAGATAAAGCCTGACGTGTACCGCTCGGGACGCGGACTCAGCCCCAAGTCTAAGCGTGTGCACACGGGGCCCGACAAC
TGAAGGAACTGCATGCCCTGCAACAACAAGCGCAGAGAAGTAATGCCCTCGTTGACATCCTTGACAATACGTCGCAACTGCGCATCGCGCTTCTGAATTT
GCTTGCGGCCCACTGAAGATGCCGAACTTGGATCACTGTCAGACAATGAATCTCGGTTTGCAAGCGCCCGATTCTTTGCAAACAGCTTCTGCACCTCCAA
CTCAATCATGTCGAGCGACGTCAAGCAGTCCTCTGGTAACAGGAAAAAGGGTTTCAGCGCTTCGATGGCACCTGCCGGTGCTCCATAGTGCTTCATCCGC
TTCGCGACAAATTTCCAACGACCTGGCTTCAGGCTTGGAGTCTGAGTGGACGGTGGGCCAGCGTGCACGTAGAAAGAAACCTCGTTCGAGAGCAGTCGTA
GCACCTCGCGACGAGCGCTAGTGGGAACGCGACAGAGGTCAAGGATGCCACGCGTCACTCGGGCGTCATTGAATCGCATGTAGTAGGATCCTAGACAGCT
CGGCAGCGCTTTGATCACGCCTGACACGACTTCCAAGCCTTCTAGCTCCAAGAAACGGAAAGACCCTCCATCATCCCAAATGATGTCGAAGTCAGACTCG
GTGAATTCGCGCGGGTGACCACCCCCGACGCCTTTCCGGTAAACGCGGTCGAATTGGAAGCATTTCAGTCGCGATACGTTGTGTCGAGCCACGAAGCGAG
CAAGTCTCTCGGTCAGATCAAATGGAAGCGATACGGACACACCATTGCCATCCAGCATCAACGATGCGTTGGGCGCAGCGTTAAGAGTGATGCCGTTAAA
GCTCTCTGACAGACGTGGCATGAGTAGCGGCGTTGACATTTCAACGGCTCCATGACGCTCGAACACTTTCTGTAAGCACACCGATATTTGGTTCAGAATT
AAAATACAGTTGTCTACCAACTCAGCAAAGCACTAAAAGGATAACTGCTTACCTGTAGCACGTTCCGGACGTACGTTTTCGTGCGCAATTGGGTCTCGTA
GATGCGCATTTTGACCGACTCCAGGTGATCGTAGGTGTAGTCGACGTGATTAACTGGTTCCTGTGATACCAGCGCGTCAATGAGCTGCCCGAAAAACTTA
CCTTGCGGGTTTGCGAGAGTTTCCAGTGCCTCGCGAAGGTAGGATCCTTCTACCTCTATCTTCGCGGGCAACAATGGACTTGCCAGCAGTTCCTTCGCAT
TTGGCCGCTTAGAAGGATCACGCTCGCAAAGCCACAGTATGATCTTTTTTACATCTTCAGACTCACTGAAAGCCGCCGGTAGCTCATGCCTTTCCCTCAA
ACCAGTGAGCGCCTGCGCACGCTCCATCAGCGTGGTGAATGGTGGTGACCACATTTCGAAAAACAGGATTCCGAGCGAGAACAAGTCTGCTTTCTGGTTG
TACCGTTGGCCCTCTCTTTCTTGTTCAGGTGCTCGGTAGAACGCCGTGCCGACTCCAGCGGTAATACTGCCATCGACCACATCGGCCGACATCGTAGTCA
TCAGATTACTGTCGTGCTGTACACTCGATCGACCGACGACTCGTGTACTCTCCAAGTTCTCCAGCTTCAGCCGCCCGTAGAGCTCGGCAGCAGATGACCC
GGTTGACTCGGATAATATCGCACCAGTCGCAGTTTCGTTTGGTGGAGAGGAATCCTCGTTGCTGCCGTCATCGTCCATAGCTTTAGGAGGCCGAACTGCG
AGGCCAAAATCTCCCAGCTTCACAGTTCCTTCAGAGTCCAGGAAAACGTTGGGCGGCTTGATGTCACGGTGAATAATACCTTGCCGATGAATGTACACGA
GGGCCTCCAGGATCTGTCGGAACATCGTCCAGATCTTATCGGGGTCTTTCCACAGTGCTCCTTTATCAATCACCTCTCTGAGAGCATTGCCCTCGCAGTA
CTCCATCTGAATGTACAGTTTCTCAAACTTGCGCTTTCTCTCAGGAGTAGGAGTTCTATGGGGAAGCGCCTTGCGATGGTAGTCGCTACCTTCATCGTCG
CTGGAGTCGTCCACATCTTCCATTGGAGCTTCTTCCAAAGCTTCCCAGTCGAAGCCATCATCTGGATAGCTCTCCGACTCAAAGCGATGCGAAGAGAGTT
GGAATGAATGGCTATTACTTCGTAGGCTGCGGCTTTCATGGCGAGACGTCGGCCATAGCCCTGTGCTGCTGCCCATTGTGCCTAACCAGTCGTCTTCGTC
CTCGTCTGTGGACGTCATGGCCCCCAATCCGTCTTCAACGCCAAACGAAAGGCTTGCGTCACCATACAAGTCTTCCTTCTCGCTTACGATGGCGCCACTC
ATGATACCCTCTTCGTCGCTTAAATCGCTGTCCTCAAGACTCGAGTCCTCTTCGTCGTCGCTAGACATTCCACTTTCACCTTCAATCCACGCCTGGAAAT
ACCGCACAATGTGGCGGTGCTGCATTCGGGAAATCGTCTTCACCTCGCGCAAGATCTTCTTCTTCATGGCTTTATCGTCCGGGTCCAGCTTCACTTTCTT
CACCGCGTAAAGCTGTCTGTCCAGGCGGTTCCGCACCTTCACCACTTCGCCTCCTCCTCCGCGTCCCAGCAGCCCCAGCTCTTTAAAATCGCCGTGATAT
CTCGAGTGATATCGTTCTGCAGCTGCAGCCGCGTCCAAATCGGACGTATCCGAGTCTGAGTCGGACAGACTCGACGAGCTGCCGTCGCGCCTTGAGCTCG
CCTCCGTCTGCTGCTCGTAGATGCTCGACAGACTCTCTCCATCGCTGCCACTGTACTCTCCGTCAATACTCGACCGATGTCTCCGCCTTCTCCGCCGTGT
CTTCTTGATCGTCTCTCGTTTCTTCCTCTCGGCGTCGATCAGCGCGATAATCTCCTCGTTCTTCGCGCGCGCCTGCGCCTCCTGCTCTTGCAGCAGCGCG
TCCTCCTCCTGCTTTTCCCTCGTCTCTCGGTCCTGCTGCCGGGTCATCATCTGGTCGAAGAACGACGACTGGTCCTTCAGGTGTTCCTGGATGAAGTCGG
TGGCGAACACCACGAGGTCGTACACGACGGCGTCCCCGACCTTCTCCAGGGCGAGCGCCTCCATCCCGCGCTGCAGCTTCTGCGTCTCTGTGTCCGACAG
CCCGTGCTTGGGCTCCACCGTGATGTTGGGTGGCTGCTGGAGCGGGTACGCGCGCGCCAAGTCGAAGTGCAGCAGCACTTCGGCCGTCGTGGCCGAGCCC
GGCGTGGCTTCGCACGCCAACCGGATGGCGAAGATATACGTATAGAGCGGCGTGGCACTCTGACTCACGAGGTCCCGGTCGAATATGGCCTGCAGCACCT
CCAGTTCCTGGGCCTGCAGCTCGCGCGCCTCGGCGAGCGTAGCGGCATCATACGTAGCGGGTGCATCTTGGACGCACGCGTCTGCAGAGCGGAAAACGGA
GCATCCCAGGTGGACATTTAGCTTGTTAGCTGCAAGAGACGTAGGTGCACACACCTACCTCTCTTCTTCCCCTTCTTGCGGCCCATGGACCGGTA