Description :
From Genome Similarity Track
Location :
contig_6:112051- 116746
Transcript NameFunction/comments
g2210.t1hypothetical protein

Sequence
4695 bases(100 bases per row)
GCGGTGGAGCTAGCGACATCATGTCGTAGCGGTCGTCCACCATGCTGTGCAGTAGCACGTATCGCTCCCGTCCGACACCGCGTGAGTTGTTGTTGGCCTC
GGGCGTGAGAGAAAGCACCTCTTCCATTGTGTACTTGAGCTGCTTCCGATACCGTGGGTTGTTGGCGCAAACGAGTCGATCGCAGCGCGTCCCTCTTCCA
TCAACGCCGACGACATCTCCCGCACCAGCGCAAACGGCAGGTCCACCGAGAGCACCTTCATGGCCTCGTCCCCGCGAGACGAAAAGCTGGACGAGATCCA
CTTGGACACGCGACGCGTGACCTTCTGCGTGTCAAGCTGGTAGTTCCGGTAGTTCCTGTCCCTCGACTGGTACTTGGCATCGACCACCCGACGTCGAAGA
TGGGCTGCAACGAGCTGCTACCTGACGACGAATTGCCGCCGCCACCACCGCTGTTGTTGCTGTTCATACCATCGCCAAATGGTTATTGCCACGGCCACCA
CTAGCAGCAGCGTCGCCATGCGAGGTCTTGCCAGACGTTGTCAGCAGCTCGCTGATGTACTCGGGCAGCGACGTCACATTCGTCACCACATCCGCTTCCG
AGTGGCTTTTCACAGCTCGAATCTTCACTGCTGCTTCTCTTTCATCATGTGCTTCTGTACGATTACCATCCACTGCACATTCTGCTGCGCGCAGTAGTCT
TCGAGGTCCTCCAGGTGCAGCGGCTCTGGATGCAGGTAATCTGCGCCGATGCCCTGTCCCACAGCAGCATCGCGATCTGCATCCGGAACAGCATCGTGTC
CGACGCCTTGCCAGCCGAGCAAATCAAGACCTTGCGGCCGCCCGTCAGCACCTCCGACGCTGGTGGTTTGGATTCCAACAGCGCTGAGCTCATGGATTCA
GCGACCAGCGACACGATCTTATCGATAGCGAAGCGCACGCCCATTGCAGCGACCGACGAGGCTTTTGCGTATGCTGTTGTGAGCTTGAAGCGCGACACCA
GCGCATCGTAGCGTCCACCCTCCGCGATGATGATCTGGTTGTCGGTCGTCGCGACCAGCAATGAGGCTGATGTATCACCAGTGGTGCCGCCATACGCGGC
CTCCCCGAGCAAAATTGCCTGGAAGATAAAGCCTGACGTGTACCGCTCGGGACGCGGACTCAGCCCCAAGTCTAAGCGTGTGCACACGGGGCCCGACAAC
TGAAGGAACTGCATGCCCTGCAACAACAAGCGCAGAGAAGTAATGCCCTCGTTGACATCCTTGACAATACGTCGCAACTGCGCATCGCGCTTCTGAATTT
GCTTGCGGCCCACTGAAGATGCCGAACTTGGATCACTGTCAGACAATGAATCTCGGTTTGCAAGCGCCCGATTCTTTGCAAACAGCTTCTGCACCTCCAA
CTCAATCATGTCGAGCGACGTCAAGCAGTCCTCTGGTAACAGGAAAAAGGGTTTCAGCGCTTCGATGGCGCCTGCCGGTGCTCCATAGTGCTTCATCCGC
TTCGCGACAAATTTCCAACGACCTGGCTTCAGGCTTGGAGTCTGAGTGGACGGTGGGCCAGCGTGCACGTAGAAAGAAACCTCGTTCGAGAGCAGTCGTA
GCACCTCGCGACGAGCGCTAGTGGGAACGCGACAGAGGTCAAGGATGCCACGCGTCACTCGGGCGTCATTGAATCGCATGTAATAGGATCCTAGACAGCT
CGGCAGCGCTTTGATCACGCCTGACACGACTTCCAAGCCTTCTAGCTCCAAGAAACGGAAAGACCCTCCATCATCCCAAATGATGTCGAAGTCAGACTCG
GTGAATTCGCGCGGGTGACCACCCCCGACGCCTTTCCGGTAAACGCGGTCGAATTGGAAGCATTTCAGTCGCGATACGTTGTGTCGAGCCACGAAGCGAG
CAAGTCTCTCGGTCAGATCAAATGGAAGCGATACGGACACACCATTGCCATCCAGCATCAACGATGCGTTGGGCGCAGCGTTAAGAGTGATGCCGTTAAA
GCTCTCTGACAGACGTGGCATGAGTAGCGGCGTTGACATTTCAACGGCTCCATGACGCTCGAACACTTTCTGTAAGCACACCGATATTTGGTTCAGAATT
AAAATACAGTTGTCTACCAACTCAGCAAAGCACTAAAAGGATAACTGCTTACCTGTAGCACGTTCCGGACGTACGTTTTCGTGCGCAATTGGGTCTCGTA
GATGCGCATTTTGACCGACTCCAGGTGATCGTAGGTGTAGTCGACGTGATTAACTGGTTCCTGTGATACCAGCGCGTCAATGAGCTGCCCGAAAAACTTA
CCTTGCGGGTTTGCGAGAGTTTCCAGTGCCTCGCGAAGGTAGGATCCTTCCACCTCTATCTTCGCGGGCAACAATGGGCTTGCCAGCAGTTCCTTCGCAT
TTGGCCGCTTAGAAGGATCACGCTCGCAAAGCCACAGTATGATCTTTTTTACATCTTCAGACTCGCTGAAAGCCGCCGGTAGCTCATGCCTTTCCCTCAA
ACCAGTGAGCGCCTGCGCACGCTCCATCAGCGTGGTGAATGGTGGTGACCACATTTCGAAAAACAGGATTCCGAGCGAGAACAAGTCTGCTTTCTGGTTG
TACCGTTGGCCCTCTCTTTCTTGTTCAGGTGCTCGGTAGAACGCCGTGCCGACTCCAGCGGTAATACTGCCATCGACCACATCGGCCGACATCGTAGTCA
TCAGATTACTGTCGTGCTGTACACTCGATCGACCGACGACTCGTGTACTCTCCAAGTTCTCCAGCTTCAGCCGCCCGTAGAGCTCGGCAGCAGATGACCC
GGTTGACTCGGATAATATCGCGCCAGTCACAGTTTCGTTTGGTGGAGAGGAATCCTCGTTGCTGCCGTCATCGTCCATAGCTTTAGGAGGCCGAACTGCG
AGGCCAAAATCTCCCAGCTTCACAGTTCCTTCAGAGTCCAGGAAAACGTTGGGCGGCTTGATGTCACGGTGAATAATACCTTGCCGATGAATGTACACGA
GGGCCTCCAGGATCTGTCGGAACATCGTCCAGATCTTATCGGGGTCTTTCCACAGTGCTCCTTTATCAATCACCTCTCTGAGAGCATTGCCCTCGCAGTA
CTCCATCTGAATGTACAGTTTCTCAAACTTGCGCTTTCTCTCAGGAGTAGGAGTTCTATGGGGAAGCGCCTTGCGATGGTAGTCGCTACCTTCATCGTCG
CTGGAGTCGTCCACATCTTCCATTGGAGCTTCTTCCAAAGCTTCCCAGTCGAAGCCATCATCTGGATAGCTCTCCGACTCAAAGCGATGCGAAGAGAGTT
GGAATGAATGGCTATTACTTCGTAGGCTGCGGCTTTCATGGCGAGACGTCGGCCATAGCCCTGTGCTGCTGCCCATTGTGCCTAACCAGTCGTCTTCGTC
CTCGTCTGTGGACGTCATGGCCCCCAATCCGTCTTCAACGCCAGACGAAAGGCTTGCGTCACCATACAAGTCTTCCTTCTCGCTTACGATGGCGCCACTC
ATGATACCCTCTTCGTCGCTTAAATCGCTGTCCTCAAGACTCGAGTCCTCTTCGTCGTCGCTAGACATTCCACTTTCACCTTCAATCCACGCCTGGAAAT
ACCGCACAATGTGGCGGTGCTGCATTCGGGAAATCGTCTTCACCTCGCGCAAGATCTTCTTCTTCATGGCTTTATCGTCCGGGTCCAGCTTCACTTTCTT
CACCGCGTAAAGCTGTCTGTCCAGGCGGTTCCGCACCTTCACCACTTCGCCTCCTCCTCCGCGTCCCAGCAGCCCCAGCTCCTTAAAATCGCCGTGATAT
CTCGAGTGATATCGTTCCGCAGCTGCAGCCGCATCCAAATCGGACGTATCCGAGTCCGAGTCGGACAGACTCGACGAGCTGCCGTCGCGCCTTGAGCTCG
CCTCCGTCTGCTGCTCGTAGATGCTCGACAGACTCTCTCCATCGCTGCCACTGTACTCTCCGTCAATACTCGACCGATGTCTCCGCCTTCTCCGCCGTGT
CTTCTTGATCGTCTCTCGTTTCTTCCTCTCGGCGTCGATCAGCGCGATAATCTCCTCGTTCTTCGCGCGCGCCTGCGCCTCCTGCTCTTGCAGCAGCGCG
TCCTCCTCCTGCTTTTCCCTCGTCTCTCGGTCCTGCTGCCGGGTCATCATCTGGTCGAAGAACGACGACTGGTCCTTCAGGTGTTCCTGGATGAAGTCGG
TGGCGAACACCACGAGGTCGTACACGACGGCGTCCCCGACCTTCTCCAGGGCGAGCGCCTCCATCCCGCGCTGCAGCTTCTGCGTCTCTGTGTCCGACAG
CCCGTGCTTGGGCTCCACCGTGATGTTGGGTGGCTGCTGGAGCGGGTACGCGCGCGCCAAGTCGAAGTGCAGCAGCACTTCGGCCGTCGTGGCCGAGCCC
GGCGTGGCTTCGCACGCCAACCGGATGGCGAAGATATACGTATAGAGCGGCGTGGCACTCTGACTCACGAGGTCCCGGTCGAATATGGCCTGCAGCACCT
CCAGTTCCTGGGCCTGCAGCTCGCGCGCCTCGGCGAGCGTAGCGGCATCATACGTAGCGGGTGCATCTTGGACGCACGCGTCTGCAGAGCGGAAAACGGA
GCATCCCAGGTGGACATTTAGCTTGTTAGCTGCAAGAGACGTAGGTGCACACACCTACCTCTCTTCTTCCCCTTCTTGCGGCCCATGGACCGGTA