Description :
From Genome Similarity Track
Location :
Scaffold_548:11205- 16730
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_548-fgenesh-gene-0.1GH16097
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_548-abinit-gene-0.21FtsJ methyltransferase domain-containing protein
Pytiw_DAOMBR242034maker-piw_contig_548-snap-gene-0.11Myotubularin

Sequence
5525 bases(100 bases per row)
GGCTTGTAGGAACGCGCCCACCAGCAGAATCCGTTGCAGGACAAGCGATCGAGACGTCTTGTGCTCGGTCTGCATGAGGTGAAGCGAGGCCTGTTGGCCA
ACAAGCTCAAGCTGCTGCTCGTCGGTACGGACGTTGAGGAATGCGGCGCTCTCGACGAGAAAGTCTCCGAGATCCTGACGATTGCGCACAGAGAACAAGT
GCCAGTTGCTTTTCCCATGACGAGGTTGGTTGGTGCGAAAAGGTTGGCTTGCTTTGCGCTTTTGTTTGTTTGTTTGACACTTTTGAAACACCATGTGTGT
TTGTTTGGTTAGACGCAAGTTAGGCCGCGTATTGAGCAAGACTGTGCGCGTGAGCTGCGTCGGAGTGTACTCTTTCGACGGCGCAAACGATCTCTTTGCA
GAGATTACCCGGCATTTGAGTCTCGCTGGTCACTCGTGAACACGCTTTTGCAGCAAACGGTACTGGGTGAAAGTTGTGTGCTTGTGCGCAACCTGTTCTC
GGCGCACTGCAATTGCTGTTTGCTAGCTTGTCAACTCGAGTCTTCAAGATCCCAGCACTTCATGTACGTCGCAGGGTCGATTCGCTCTCTACAGCAGCTA
CACGACAAGAACAAACAAGCAACATGTGAGTGAACGAATCTTGCGTGGATCAATGTGCCAACTGTGTGTCCACCGTTTTCGCTTGCTTCCTCCATTTGCG
ATGTCAAGAATGCGTCGACATGCGTCAATCTGCGCCTGCGCAAGTCTGTCGTTGACTGCGGCCATGAACTCCAGAAAGCAGGCATCTGCGCTCACCACAC
TTGCGTCAAAGAGCAGATTCATTCCTCCCTCTGGGGCCTCCAGTCGCGCCTCAAGCGTCCAGATGATCGCGTCCATCGGCAAGTGCTTGTGGCGATTCAT
CGCAACCAAGTACCGCTCGGAGCTCGCAGGTCGACTTGTCTACAGCCACACACACAAGCAAACAAGCAAGCAAGTCAAAAGTCAGATGTGAGCAAGCCAA
GTTAGCAAGTTTCGGCACAACCTGCCAACAAGCAAGACTCACGACTGGCTTGACAACCGTGATCTTCTCAAAGCACTTGTGCAGCAGCCACACCAGCTGC
AGCATCACGGGCGTCGCGAGCTCAAACGTCTTGCATACAAAGTTCCCGCCTGCGCTCAGGACGGAGAACATCGTGAGCACCTCGGCGAGCACGAGGCGCG
TCATCATGAGTTCCTGGTTCCGTTGGTCGCGCGCGTCCTGGAAGCCGCCGTCTGCGACCACCAAGTCCACGCCCAGCGGGTGGTTCTGGAGTACAACCTT
GTCACGGAAGTGTCGGATGTTGCTGAGTTTGTAGAGATCTCCCGTGCCGTCGTCTCCATACGAGATCTCGAACGAGGCGTGGGGACCGAGCTTCCAGTCG
CAGATCTCGTCCTTGAGCGAGATGCCATAGCCTCGAGGCTGAGCTGAAGATGCTGCTGCTGCTGCTTGGGCTGAGACTCCTCGCCACAGGAGGTACTCGG
AGAAGCCGCCGGGCCCGCCACACACGTCTGCGAATGTAAACAGCGAGCCGTTTGCTGTGGTGAGCTGGAAGACGTGGTCCAAATTGACGAGTTTCATGGC
CGAGCGGTTCAGGAACGGACCGCGACCGACCGACTCGTACGGGTTCGCGACAGCACGTGCTCGGCGGAACGTCGTGCTGCTCAGCTCATCGAACCTGAGT
CACACAAGTCACATGATGTCATTAAACACGCATATTGCGCTTTAGTGACAACAGAAAACACGCACCGGTTCTTCTCGTGCTGGAGCTTGTCGAGCAGTTC
GTAGCTCCGTGCTGGGAGCAGCTCCGCCGTCGCTGCGTGGTCATTGCCATTGCAACTGACAGCAGTCGGACTGCTTAGTAGTGCCGCGAGTGATCCAGCG
CGGCTCCTAGTATGCACACCATCGCGGCTCGAGTCGCTCACCAGGAACGTGACGCCGTGCGCGCCAGTCTCCAGGCGCGTGGGGTCACACGAGCGCTGGA
GCTGCTCGCACAGCTCGGTGCCTGGAGCCACTTGCACTGGTGGCCACTGCGAGTGAGTCGCAACTGCTCCCGTCTGCTTGTGTTGTGCCGCGCGCCGCTT
GCGATTGCTTGCAGCGCCGCCGCCGAACGAGGAGAAGCCCATGAGCGCCTCCATATCGTCCATCTTGATCGAATTTGCATGTGTGTGTGATGTGCAGGGC
GCTCTATTTGAGACCTCTGGTGCTAGAACAGAGTCCCATTGCGAACGTATCGGGTGGTGCTATTGTACGAATCTATCGCGAACACATGCAATTATTACTC
TCACTCAACGCTCTCTGCTGTCTTCTCTCCAAGCGTTCGCCTCGCTTGAGCGATTTCTCTCAGCAGCTGACTGCATTCTCCATCCACTCAAACGTTCAAT
GCGCCTCCTTGGCTGTCCTGGCGGTTGCGACTCATGGCCATGCGGTGATGCATCGAGTCCAGTTCGGCCTCCAGCTGCAGTTCGCGCGCCACACTCTCGC
TCAGCAACTGCTCCAGGTACTTGATGCGGCTCTGGTCGGGTGCCTCCTGCAGCGCCTCGCGGATGTTTCGGCCCTGTGCGCGCTGACGAGTTCGCTCTTC
AGCGCCTCGACGGTATCGCTCGAGAAACTCGTCGTCCAGGTCGTAGTGACCACCTGGCGGCGCGAAGTCAGTCATGACGCTGTGTGGTGTTTCGTTCATT
GAGATCGTTGATGCCGAAAAAACGGCAGACATGCTGGGCGACGTCGCGAAGTTGTCTTCGTCGTCGCTCATATCGGAGCAATCTGAAAGTGCCATCCGGT
GCCGGAAGTCATCGTGGTAATCATGAATCACGTCGATGTCGAGGCGGAACGCTTTCTCTTCGTCGTCTAGATCGCTCGCAACCATTGGGCCGAGCGGCGG
TGAGCTTGACGACGCATTCGCAGCACCATCGCCGTCGTCAGTCGCTGGCTCCATATATTCCATGTAGTCAGGATGGCTCTCAGGATCCCAGCGGAAGAAC
ATCGCGTCCCACAGCACCACTCGCTTCAGGTTGGCGCGGGGGTACAGAACGCGGTTCGTCGAGCGGTACAGCGGGTTCTTGTACGGAGTCGGGTTCTCCA
GCACTGGTGTCCACACCGACTCAGTGCATTCCCACACCTTGTCGAGAAGACGCTCGCGCTCGGAGTTGAACAGGAATGTGCCGTACAAACCAGAGAGGAG
GGCGTCGGAGATGTGCAGCAAGAATTTCTCGTTGAACTCGAAGCACGTCGGGAACTGACGGGTCATCTGCCATACACAGTCCAGGAACTGCAACATCACT
GGCGAGCGCTCGTTTGGGTGTTCCGTGATGTCTTTGCCGATGCCGATACGGTCCGCGAACTTGTGACCGAATGAGCACCATTCCTTCTCGACCAGACACG
CAAATCCTCGGATTGTTCGGTAGTAAGGGTCGAGGATCAGCTGTGCGAGCGCAACAAGCTGGGGTGTGCGGTCCCAGCCATCGCTACAGTGGACAAGAAC
CGACGCGCCGTCTTCATGGAGCACTTCAGCAACACGTCGAGCGCCAGACAGGACTCGCATCACATGCTTCAACCATCTTGTGTCTGTGAGCAGCACACAA
AAAACAGTCGTTTAGTCATGGAGGGTCGACATCAAATACACAAAGCCTCGTAATGCACAGCAACGTACTCTCGAGACGATGATGATAGTTCTTGTCGCCA
TCTTCAACACTACTTGGACTAATCAGGGCTGAGCAAGTACAAAAAAAAAAATACATGTTAGTACACTGGCAATACGTGTTCACAACCAGCAGTAACACTC
ACTTTTCAAGGCTTCAACGGATTCACGCATCTTGTGAATGTTCGCGATACCCATGAACTCGATCGCAGCATTATCGTAATGCTGCGAGTTCTCGACGCCT
GCGCAAAAAAAATTCACAAGACACAGTCAGTATTTTCTCGACGACGCAGTCAGTTCAGCCACACGGTTTCACATACCTTTTCCTTTTAAGCGATTGCCTT
TCGTAGCGATCGGTTTGCGCGCATCGATAATGTGCAGGGGCGGCGACACGTTGTTGCTATTGGTGTTCGCGGAATCGCGATAGGCTCGGAGCAGGATTCG
GTCTGGCTCGGACTTGTTGCCTGCCATGCCGTAGTTCGGCTGACTGGAGCGAGAGAGCACGCTGTGGTTCACAGGGTGGCGCCACACAGCGACAGGAAGT
CGGGCACGGGATCGGAAGCGAGCCGACTGAACGAGCTGGTCTTCAGACATAATCGAGGGCACAATCATCGTCTGCGGATACGTCGGGCTGAAGCGGAACT
TGTAGTTCTTGAGTATTCTCCATGATGTCCCCGTCGCATTCTCGTCTTGGTCCCTTCTCGCACGGTCTCCACTACTGCGCAGGAAACCCAATCGCGTGTA
CTCCGTGTTTGGAGAGTACAGGAACCAGCCATTGTTCTTTGGGTGAGGAGGTCCCCTCTGTCGGATCTTCTCTGTGTGGTAATCAAACGCGAACAGTCCG
AATATCGAGTTTGGGGGCTTCATGCGCAGCGTCAAAAGGTTGAGCCAGCGGAAGTCGGGTGTCGTCGGCAGCTGGTCGTACCCTTTCTTGCGCGTGTACG
CGTCGTGCATCGCGAGGCGAATCGTACGCAGATCCTTACACGCGATCAGGAGCATCAGCCCATCTCGCGTGATCAAGTCGATCGTCGCGAGCGGCACCTC
GAACGAGCCAAACTTCCACGAGGCGTCGTAGGGCGTGAACGTGATGCGGTAGGTCGTGATCTTCAACACGCCTTGCACCGCGCGGTCGCTCTGGGACATC
ACGACTAAATTCGTCACGCGCTGCACGTGCTCAAGGACGTTTTCACCTGGGAAAAGTTTGAAGTTGTCGGTCACCATCGAATCGCGAAATCTGTTGCGCG
CAACGACCGAGTCGGACGAGCTGATGAACGATTCATCGAGTGTCGCCTCCGTGGGCGTGCGAGTCGACTGGTTTGGCTTGTAGATCACTTTCCCCTCTTC
GAGCGCCTGCATGAAGTTTGCGCGGTCTTCCGTGCTGTAGAACGTGATCTTCTTGGTCAGCGACGCGTTCCCCGTCTGGATCTTCAGCTGCATGCCCAGT
CGGGAGTGCGGGCGGGCCGTGATTGCTGCACAGGAGTAACTCTCTCGATTGTCGTGAGGCGACAAAAAGTTCAGCATGCGCGTCTCGATGTCGACCTGGA
GCTGGATCGATGCCTTCTTGCTGCCCAATTTCTCCAGCACACTGTCTGACTTCTTGACCGTGAACGTGAACAGCGTGACTTCGGAGCGTGGCGGCGTGTC
GCGGTTAAACCCGAAGATATTGTGCGAGGATCGACTGCGGCCTTTCTCCGCCATAATGTTCGTCTCGTGCAAATCCACGGGCGCCTTGAGACCGAACGAG
AGGGGCTTCTCGTATATGTTGGAGCTCGCCATCGGATACGTGCCCAGTGATGACCGTCCCCCTTCTCCCCCTCGAGGGATCTCAATCGGATACTTCGGAG
ACGACGACAGCACATTCGGCATCGA