Description :
From Genome Similarity Track
Location :
Scaffold_32:112039- 113178
Transcript NameFunction/comments
Physo_134465reverse transcriptase

Sequence
1139 bases(100 bases per row)
GCATACACTGCAAAGTCTGCAATGAACCGGTGGTAGTAGTTGAGGCTACCCAAGAACGATTGCAGGCCCTTGAGCGTGCGCGGGAACTCGAGCGACGTCA
GCGACTCCAGATTCTTCGGCTTCGCCTCGAGACCGAGTCCTGAGACTCGGTGGCCCAGGTAGTCGACCTTGGACATACCCCACTCGCTCATCTCGACACT
GATGGACAAGTGCCACTGCTCGCATACATCCAGCAAGTGTTCGACCTTCTCGCACAGGTCGTCCCACGACGTGCCCCCGATGAGGATGTCGTCGATGTAC
GACCTCTGTCCCAGAATGGAGTGAATATCTGGCTTCACCGGTTCGCCGTCTTCAAAGACGTCCCGAGTGCTGCCATCCGGGGACAGCTTCATGAACCCGT
AGAGCGCGTTGTCGATCAAGCGTTGGTAAATCTGCGGCGCGTTGCACAGGCCGAACGGCATACGCAGCCATTCGTACAGTCCCATCGGCGTGATGAAGGC
TGAGATGAGCCGGGCCCGGTCTGTCATGGGGACGACCCAGAAGCCGCTCGCCATGTCGAGGGAGCAGTACCACAGATTCTTGTCCAAGTCTTCGAGCAAG
TCGTTGACGAGCGGCATGGGGTAAATCATCAACTGTGTCAGCCCGTTGATGAGCCTGTAGTCAATGCAAAGCCGGATATCGACGCCGTTCTTCTTTATGA
TCACGACAATGGGCGACGCCCACGGCGACTTCGACTTCTGGATCATCCTCGCGCTCAGCAGCCCTTTGATTAAGTCGGCGACCTTCTCTCGAAACTGCGG
CGGGATTTTCCGGACGCGTTGCGCGACGGGTTTTGCGTCGCCCACGTCAATGTCGCAGACAACACCCAGGGCGGCCGGCGGCAAGGCGTTGCCTTTGCCG
ATCAACCACTTCCGTCGCTTCCAGATGATTTGGTGTAGCCGCGTTTCTTGTCTCGCGGCTTCCTCGGGCGGGAGTCCAGTCGCCATGCCGACCTTCAAGT
CCTCGATCTTCACCTCGGCGGTCAGCGAGAGGTCTGGCAGCACTGCCATCTCAGACTCGAGATCCTCTACAAAGAGGTCGGACCCCTCGTGGATGAGGAC
CGCGTCGTCTTCCTCCTGCTCATCAGGTTTCGCCTCGTC