Description :
From Genome Similarity Track
Location :
Scaffold_1156:1120- 4180
Sequence
3060 bases(100 bases per row)
AAGCCATCTTGCGCCCGGAGCCGAGACAACTCGGGACGCGACGCGCCGTGACCCCAGTGTTGGCGGCTGTCGCGGAAGCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGTGATCGTGTACGCCAGCGA
CTGGGCGATCTCAGGGGTGCTCACGCAGCTCCACGACGAAGTGTACATGCCTGTGAAGTTCACTAGTCGTACGTTGAAGCCCAACGAGCTGAACTACGAC
ATCGTCGAAAAGGAGATCTTGGCCCTGTTGCGCGTCTTAAACGAGTGCTACACGATGCTAGGAGGGAGACCAGTCCACGTCTTGACACGTCACACGACAC
TCGCCTGGTTGTTCCGGTCCAAAGGACTACAGGGGCGACTGTCACAGTGGGCCGCGATCCTCTCGCCGTGGAAGTTGGAAATCTGCTGATCCATGAAGGG
AGAAGAAGAACTCCTCGGCGCGCTGGCCGCGAGCATTACCCCGCGAGCCTTCGTCGACGCGGCGCTAGAAGAGATCGCCCCACGGAGACGGGCGTCCAGG
ATTGTAGTCATTCCAGTCCCCGACGTGGCGCACGACGAGGCCTTGCACGTTTTGAGCTTTGACGGATCGGCCAAGGCGAAGCGAGAAGGCGGAGCATACA
GTGCCGTCATTTGGCAGCTGCCGAACTGGGAGATCGTGCGCGCCGCGTCGGGATATGCGACGGACCTCACGATCAACGAGGCGGAATACCGCGGGCTGCT
GCTCGGATGTTCTCTTCTAGAGGAACTCGACGACGTCACCCGACTCGTCGTATGCGGAGACTCCAACCTTGTCATCAGGCAGATGCGGGACGAGATGGAC
TGCAAGTCCCCGGGGCTGAAGCTGCTGCGACAAAAGACGCGAAATGCACTCCAGGCATGGCCGCGCCACGAACTCTTCCACGTACGACGAGACTGGAACG
CGAGTGCCGACATGCTGGCTGGACAAGCTCTGCAGCGTCAAGGAGGTCGCAACGCGCACAGCCCCGAAGAGATTCAAGATCTGAAGACGCTGAATCGCTT
GGAAGAAGTCATCCGACCACGGGCATCGAGTCCCGAGATGGCGTCTCCAGCCAGTCCCGACGCGGAAAATCGCGACGCGGAAAATCGCGACACGAAAACG
CGCGGCGCAGATGACCCCGCCGGGAAGGCCATGGACGCGGGACGCGGGACAGCACAAGTCCTCGCGGTGACGACGCGCTCGGCTGCCGCACGCACGACAA
CACGTAGGGCCCGTCCTCCAGAAGTCCTGGAGGAGCGGGTGGTGCAACGACTGCGCCTGGACCGCATCCACGTCGCCCAGGACGAAGAGGTCTGGATCGT
CAACCTCAAGAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCACCTCAGTACGAAGAGGGCGAAGGC
GGGCTGCTCTACTACTAGCCGAGAAGCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATCCCGGAGACTCTTCGGGAAGATGTACTCC
ACCACTATCACGCGAGCCTGGAAGGCGGACACCAGGGTATTGGCCCCACGTACCAACGCGTGAGGCGCCACTTCCATTGGCCAGGGATCTTCAGAAGCGT
CCAGCGCTACGTCGACGAATGCACCGACTGCGAGACGGGAAAGGGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTCGCGACGTACCCGTTC
CAGGTCATTGCCATGGACCATATTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTGGGTCGACCTCTTCACGGGGTTCGTCGTGG
TCAAAGCGAATGCATCACGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGGGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGC
GAGCCGGGCTTCATGTCCGACTTCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAG