Description :
From Genome Similarity Track
Location :
Scaffold_1308:1120- 3628
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1308-snap-gene-0.3Vacuolar protein sorting-associated protein 35

Sequence
2508 bases(100 bases per row)
GCGGCGATCGCGCTGGACGCGCAGGCGCAGGAGGAGCTCCTGAAGGAGGCGCTGAGACAGGCGCGCGACCACGCGTTCCGCATGAAGCGCGCCATGGACG
CCGCCGAGCTCAGCGCCGTGCTCAAGCACGCGGCCGACGTGCTGCGCGAGCTGCGCACGAGTCTGCTCTCGCCGAAAAACTACTACCAGCTCTACGTGCA
GGTGCTGGACGAGCTGCGCCACTTGGAGAGCTACGTGCGCGACCTCCACGTCAGCGGCGCGTCCATGCGCGCGCTGTACGAACGCGTGCAGAGCAGCGGC
AACGTGCTGCCGCGGCTCTACCTCTTGGTCACCGTCGGCGCCGTCTACATCGAGTCCAAGGAGGCGCCCGCGAGCGACGTGCTGCAAGACCTCGTGGAGA
TGACCAAGGGCGTGCAGCACCCGCTGCGCGGCCTCTTTCTGCGCAACTACCTGGCCGTGAGCGTCAAGGACAAGCTGCCCGACGCCGGCAGCGAGTACGA
GGGCGCGGGCGGCTCGCCGGCCGACGCGATCGCGTTTCTGCTGCAGAATCTGAGCGAGACGAACCGCCTCTGGATCCGCATGCAGCACACCAAGGCCGGC
GTGGCCAAGGACAAGGCGACTCGCGAGAAGGAGCGGCAGGATCTGCGCCTGCTGGTCGGCACGAGCCTCGTGCGGCTGAGCCAAATGGACGGCCTCACGC
CCAGCGTGTACGCGAGCCACGTGCTGCCGCAGCTGCTCGAGATCGTCGTGCAGTGCAAGGACCGGCTCGCGCAGCAGTACCTGTTGGACTGCGTCATCCA
AGTGTTTCCCGACGACTTCCACCTGCAGAACATCGGGCCGCTGCTGCGCGCGATCGCGTCGCTCCACGACAGCGTCGACTGCGGCGCGATCCTCATCACG
CTCTTGGAGCGGCTGCTCAAGTACCGCGAAGGGCTACAGGACCTCTCGCAAATGTATGGCGCCGACCACGCGACCAAGCAACTCGAGGTCTTTCAGGAAA
TCCTCGACACGGTCGCCCGGCTCACGCAGAACCCCGCACGGTGCACACAAAGCGAGAACGTGCTCTCCGCCGTCTCCATGTTTGCCACGCTCACGACGTT
CACGCTCACGTGTCTGGACGACAGCGTGGAGTGTGCGAAGCGCGTCGCGAGTGCGGCGCTGGCGTTTCTCCAGGACCACCACGCGACGCTCGAGACAGCC
GATGCGACGCCGCAGATCGAGCAGATTGTGCAGAGCTTCTTGGACAGGTTCTCACTCGAGCAGCTGCGGGGCGTGGACGCCGTCGGTGCCATGGCCAAGC
TGCTGCCGTGGAAGACGACGCGCAAGCAGCTCGCGCGGCAGTGGATCCGCTCGCTGTTTCTGCGGCGGGAGCGAGCGACCTGTGTCGAGGACGCCGACGT
CTTGCTCGATATGCTGGCTCCGCTCATCCGCGACGACCCGAACGACCAACCGCTCTCGAGCGAGCCCACGGCCGCCCACAAGGACGAGTTCGAAACCGAA
CAGCTCCAGCTTTCCAAGGTCGTCCACCTCTTCCAGTGCGACGACCTGGACACGAAGTTCCGCATGTTCTCGCTCGCGCGGCGCAGCTTTGGCCAGGGCG
GCGTCTTCCGCATCCGCTTCACGCTCGTGCCGCTGATCTTTGCATCGCTCGCACTGGCGCGAGGCCTCGAGGCGGCCGAGAAGACCAGGGGCTTTGAGAC
GACGCCCCGCGAGGTACTCCAGTTTGTCCACGAGATGGTCACGGCGCTGGCCTCGAAGCTCGAGCAAATGTCGGTCACGTGCGTGAGTCTCTTTCTGCAG
TGCGCGCTGGTCGCCGACCGCTGTGACTTTGAAGCGATTGCGTACGAGTTCATCACACAGGCGTTCATCGTGTACGAAGACCAGATCACCAACTCGCGCG
AGCAGTGGAAGGCACTCGAGCTCATGGTCTCGTCGGTGCGAGCGACGACGCACTTGTCGAGCGCCAACTACGAAGTGCTCGCGACCAAGACGACGCAGTA
CGCGGCCAAACTCCTTAAGAAGACCGACCAGGCGGCCATGGTGTTGAACTGTGCACACCTCTTTTGGGTACGTACGTGACTGTATGAATAGCGACGCGGA
AGACCTCACACGCTGTGTCTGCTATTACAGCACCCCAGCCACAAGGACGGCAAGCGCGTGCTAGAGTGCTTGCAGCGGTCGCTTCGCATCGCCGATGCGT
GCGGCGGCAGCGGCGCCAGTGTGGGCCAGTCGTCGGTCACGAAAGTGCCACTATTTCTTGACATTTTAGAAGCGGTACGGTATCTGTATCCAATTGCGTG
ACCACTGACAGAAGACGACTAACAGATTTTCTTTTTGGTCTAGTATCTCTACTTCTTTGAGGCCAAGACGCCCGCCGTCTCGAGCAATTATCTATCGGGG
CTGCTCGCACTCGTCAAGGAACACTTGGAGAACATGGAACACGGCGCGATCCGCAGCGAGAGCGAGCTGCGGTACCGCGACATCCGCCGCTACATGGACA
GCAAGGCG